ID: 983380072

View in Genome Browser
Species Human (GRCh38)
Location 4:166981122-166981144
Sequence GCTGAAAGCTGGACACTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 15, 2: 34, 3: 116, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983380072_983380082 19 Left 983380072 4:166981122-166981144 CCAACAAGTGTCCAGCTTTCAGC 0: 1
1: 15
2: 34
3: 116
4: 281
Right 983380082 4:166981164-166981186 GGTAGCTCCTTTCCACAGGAAGG 0: 3
1: 57
2: 169
3: 345
4: 605
983380072_983380076 -2 Left 983380072 4:166981122-166981144 CCAACAAGTGTCCAGCTTTCAGC 0: 1
1: 15
2: 34
3: 116
4: 281
Right 983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG No data
983380072_983380075 -3 Left 983380072 4:166981122-166981144 CCAACAAGTGTCCAGCTTTCAGC 0: 1
1: 15
2: 34
3: 116
4: 281
Right 983380075 4:166981142-166981164 AGCCCAGAGGAGACCCATAGTGG No data
983380072_983380083 20 Left 983380072 4:166981122-166981144 CCAACAAGTGTCCAGCTTTCAGC 0: 1
1: 15
2: 34
3: 116
4: 281
Right 983380083 4:166981165-166981187 GTAGCTCCTTTCCACAGGAAGGG 0: 1
1: 1
2: 18
3: 68
4: 188
983380072_983380081 15 Left 983380072 4:166981122-166981144 CCAACAAGTGTCCAGCTTTCAGC 0: 1
1: 15
2: 34
3: 116
4: 281
Right 983380081 4:166981160-166981182 AGTGGGTAGCTCCTTTCCACAGG 0: 49
1: 151
2: 281
3: 389
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983380072 Original CRISPR GCTGAAAGCTGGACACTTGT TGG (reversed) Intronic
900197853 1:1386152-1386174 GCTGGGAGCAGGACACTTGGAGG - Intronic
900915710 1:5636873-5636895 GCTGAATGCTGGATCCATGTCGG - Intergenic
901936643 1:12631289-12631311 GCTAGGAGCTGAACACTTGTGGG + Intergenic
902276815 1:15345883-15345905 GCTGAAGGCTGGAGGCTTTTAGG - Intronic
903672097 1:25042567-25042589 GCTGAGACCTCAACACTTGTTGG - Intergenic
904365701 1:30009857-30009879 GCTGAGAGCTGAACACTCGATGG - Intergenic
904443815 1:30551306-30551328 GCTGAGAGCTGGACACTTCTTGG + Intergenic
906142296 1:43540887-43540909 GGTGAGAGCTGGAAACATGTTGG + Intronic
906858577 1:49333964-49333986 TCTGAAACCTGGTCAATTGTAGG - Intronic
907020233 1:51059852-51059874 GCTGAGAGTTGAACACTTGTTGG + Intergenic
907020264 1:51060060-51060082 TCTGAGAGCTGGACACTTGTTGG + Intergenic
907761866 1:57368613-57368635 GGTGAGAGCTGAACACTTGATGG + Intronic
907860488 1:58347965-58347987 GGTGAGAGCTGGACCCTTGGAGG - Intronic
909238241 1:73180402-73180424 GCTGAGAGCTGAACACTCGATGG - Intergenic
910259909 1:85284553-85284575 GCTGAGAGCTGAACACTGTTGGG + Intergenic
910259919 1:85284621-85284643 GCTGAGAGCTGAACACTATTGGG + Intergenic
911540067 1:99146972-99146994 ACTGAGAACTGGACACTCGTTGG + Intergenic
912013695 1:105005261-105005283 GCTGAGAGCTGGACACTTACTGG - Intergenic
912572299 1:110633495-110633517 GCTGACAGCAGGACACTGATAGG + Intergenic
915751352 1:158213464-158213486 GCTGAGAGGTGGACACTTGTGGG + Intergenic
915828752 1:159105613-159105635 GCTAAGAGCTGGACACTCATCGG - Intronic
916463615 1:165050352-165050374 GCAGAGAGGTGGACAGTTGTAGG + Intergenic
916518467 1:165542071-165542093 CCTGAAACCTGGACACTCATGGG - Intergenic
916648778 1:166816216-166816238 GCTGAGACCTGAACACTTGCTGG - Intergenic
918757347 1:188355555-188355577 TGAGAAAGCTGGACACTTGTTGG - Intergenic
919249117 1:195030290-195030312 CCTGAGAGCTGGACACTTGTTGG - Intergenic
919513405 1:198493969-198493991 GCTGAGAGCTGGACTCTTGTTGG - Intergenic
921766898 1:218983154-218983176 GCTGAGAGCTGGACACTCTTTGG - Intergenic
923328199 1:232898956-232898978 GCTGAGGGCTGCACACTTGTCGG + Intergenic
923391398 1:233516380-233516402 CCTGAGAGTTGAACACTTGTTGG + Intergenic
923631809 1:235654422-235654444 GCTGTAAGCTGAACAATTCTCGG - Intergenic
924679965 1:246221157-246221179 GCTGAGAACTGAACACTCGTTGG + Intronic
1062771880 10:107870-107892 GCTGAAAGTAGCACACATGTAGG - Intergenic
1063175036 10:3543649-3543671 GCTCAAATCTGGACCCCTGTGGG + Intergenic
1063959854 10:11298135-11298157 GCTGAAAGCTGGACTAGAGTTGG + Intronic
1065407919 10:25389443-25389465 GCTGAGAGCTGAACACTCGTTGG + Intronic
1066017214 10:31259988-31260010 GCTGAAACATGGGCACTCGTGGG + Intergenic
1067701594 10:48577124-48577146 GATGAAAACTTGACACTTCTAGG - Intronic
1068222693 10:54064162-54064184 GCTGAGAGCTGGACACTTATGGG - Intronic
1068283659 10:54909009-54909031 GCTGAAAGCTGGACACTCGTCGG - Intronic
1068474464 10:57507432-57507454 GCTGAGAGCTGGACGCTCATCGG + Intergenic
1069121842 10:64577179-64577201 ACTGAGAGCTGAACACTTGTTGG + Intergenic
1069156309 10:65034926-65034948 GCTGAGAGCTGAACACTTTTTGG + Intergenic
1070977308 10:80615307-80615329 GCTGACTGCTGGACAAATGTGGG - Intronic
1071166759 10:82816384-82816406 GCTGAGAGCTGGACACTCATCGG - Intronic
1073716095 10:106109093-106109115 GATGAAAGGTGGATTCTTGTAGG - Intergenic
1073861268 10:107744408-107744430 CCTTACAGCTGGACACGTGTTGG - Intergenic
1074110085 10:110416869-110416891 TCTCAAAGCTGGCCACTTATTGG - Intergenic
1074301780 10:112240125-112240147 GCTGAGAGCTAGACACTCATTGG - Intergenic
1077012858 11:386585-386607 GCTGAGAGCTGAACACTCGTTGG + Intergenic
1077844677 11:6012405-6012427 GCTGATAACTGAACACTTGCTGG - Intergenic
1077912735 11:6587159-6587181 GCTGAGAGCTGAACATTTGTTGG + Intronic
1078315130 11:10288506-10288528 GCTGATAGCTGAACACCTGTTGG - Intronic
1078874331 11:15378435-15378457 GTCGAGAGCTAGACACTTGTCGG + Intergenic
1078874352 11:15378573-15378595 ACTGTGAGCTGGACACTTGTTGG + Intergenic
1078926405 11:15879492-15879514 GATGACAGCATGACACTTGTTGG + Intergenic
1080583926 11:33665304-33665326 GCTGAAAGCTGAACACTCCATGG - Intronic
1080966966 11:37224524-37224546 GCTGAAAGCTGAACACTTGTTGG - Intergenic
1081010961 11:37812086-37812108 GCTGCGAGCTGGACACTCATTGG - Intergenic
1081927166 11:46840619-46840641 GCTGAGAGCTGAACACATGGTGG + Intronic
1084398565 11:68930775-68930797 GCTGACAGCTGAACACTCGACGG - Intronic
1085249640 11:75134471-75134493 GCTGAAACCAGGACAGTTCTGGG - Intronic
1085334187 11:75678646-75678668 GCTGAGAGCTGGACACTTGTCGG - Intergenic
1085874808 11:80393234-80393256 GCTGAAAGCAACACACTTTTTGG + Intergenic
1086092809 11:83021002-83021024 GCTGAGAACTGAACACTTGTTGG + Intronic
1086508263 11:87528430-87528452 ACTGAGAGCTGGACACTCATTGG - Intergenic
1086737278 11:90321952-90321974 GCAGATAGCTGCACACATGTGGG + Intergenic
1086947032 11:92853680-92853702 GCTGAGAGCTGGATACTCCTTGG - Intronic
1087037861 11:93772810-93772832 GCTGAGAACTGAACAATTGTTGG - Intronic
1087338880 11:96877996-96878018 GCTGAGAGCTGAACACTCATTGG - Intergenic
1088287931 11:108206888-108206910 ACTGAGAGCTGGATACTCGTGGG - Intronic
1088651177 11:111958971-111958993 GCTGAGAGCTGAACACTCATCGG + Intronic
1088812632 11:113401850-113401872 GCTGAGAGCTGGCCAATAGTTGG - Intergenic
1088859382 11:113785581-113785603 CCTGAAAGCAGGAGGCTTGTTGG + Intergenic
1089843068 11:121435550-121435572 GCAGAAAGCTGTTCACATGTTGG + Intergenic
1090136977 11:124209361-124209383 GCTGAGAGCTTGACACTCATTGG - Intergenic
1090136991 11:124209475-124209497 GCTAAGAGCTGGGCACTTGACGG - Intergenic
1091663002 12:2398535-2398557 TCTGAAAGCTGGACAGCTGGGGG + Intronic
1092503010 12:9065911-9065933 GCTGAAAGCTGAACACTCAATGG + Intergenic
1092503020 12:9065982-9066004 GCTAGAAGCTGAACACTCGTTGG + Intergenic
1093183007 12:15988429-15988451 ACTGAGAGCTGGACACTTGTTGG - Intronic
1093525679 12:20101860-20101882 GCTGAGAGTTGGGTACTTGTTGG - Intergenic
1093764932 12:22952335-22952357 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1094018120 12:25885172-25885194 GCTGGGAGCTGAACACTTGTTGG + Intergenic
1094427354 12:30328706-30328728 GCTGAGAGCTGAACACTTGATGG + Intergenic
1095632450 12:44394356-44394378 GTTGAAAGCTGGGCACTAGAGGG - Intergenic
1095650130 12:44597896-44597918 GCTGAAAGCAGGACAAATGCAGG + Intronic
1096295617 12:50381437-50381459 GCTGACAGCTGGACACTCATTGG - Intronic
1097140663 12:56900208-56900230 GCTGATAGCTGAACACTTGTTGG + Intergenic
1097360764 12:58655990-58656012 GCTGAGAGCTGGACACTCATTGG - Intronic
1097500289 12:60392761-60392783 GCTGATAGCTGAACACTCATTGG + Intergenic
1098671393 12:73235100-73235122 GCTGAGAGCTGGACACTTGTTGG - Intergenic
1098790605 12:74817175-74817197 ACTGAGAGCTGGATACTTATTGG + Intergenic
1098802955 12:74985298-74985320 GCTGAGAGCTGAACACTCATCGG - Intergenic
1098956912 12:76697192-76697214 GCTAAAAACTGGGCACCTGTCGG - Intergenic
1099049729 12:77768051-77768073 ACTGAGGGCTGCACACTTGTTGG - Intergenic
1099683377 12:85856707-85856729 GCTGAGAGCTGGGCACTTGTTGG - Intergenic
1102060480 12:109927218-109927240 GCTGACAGCTGAACACTTGACGG + Intronic
1103092557 12:118107767-118107789 GCTGAAAACTGGCCAGTTATTGG - Intronic
1104151525 12:126088622-126088644 GTAGTAAGCTGGACAATTGTAGG - Intergenic
1104805585 12:131587270-131587292 GCTGACAGCTGAGCACTCGTCGG + Intergenic
1106537432 13:30659896-30659918 GCTGAGAGCTGAACACTTGAGGG - Intronic
1106868631 13:33994917-33994939 GCTGAAGGCAGGAAACCTGTAGG + Intergenic
1107841199 13:44459373-44459395 GCTGACACCTGGACACTTATTGG + Intronic
1108240292 13:48457266-48457288 GCTGAGAACTGAACACTTGTTGG - Intronic
1108542389 13:51456220-51456242 GCTGAGAGCTGGACACTTATTGG - Intergenic
1108542536 13:51457004-51457026 GCTAAGAGCTGGACACTTATTGG + Intergenic
1108796389 13:54036234-54036256 ACTGGAAGCTGTACAGTTGTGGG - Intergenic
1109396461 13:61766025-61766047 ACTGAAAGCTGAACACTTGTTGG - Intergenic
1109478709 13:62919492-62919514 GCTGAGAACTGGACACTTATTGG - Intergenic
1109603619 13:64663432-64663454 GCTGAGAGCTGGACATTGGTCGG + Intergenic
1109683487 13:65783872-65783894 GCTGAAAGCTGGACACGTGTAGG - Intergenic
1109944864 13:69420403-69420425 TCTGACAGTTGGATACTTGTAGG - Intergenic
1111002704 13:82205833-82205855 GCTGAGAGCTGAACACTCGATGG + Intergenic
1111243769 13:85508555-85508577 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1111304026 13:86382790-86382812 ACTGACAGCTGGACACTCATGGG + Intergenic
1111337198 13:86839800-86839822 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1111549071 13:89783904-89783926 GCTGAGAGCTTGACACTTGGTGG - Intergenic
1111903695 13:94230718-94230740 GCTGTATGCTGAACACTTTTAGG - Intronic
1113503112 13:110793735-110793757 GCTGAGGGCTGCACACTCGTTGG + Intergenic
1115059144 14:29169033-29169055 ACTGAGAGCTGGACACTAGCTGG + Intergenic
1118200067 14:63663457-63663479 GCTGAGAGCCGAACACTTGATGG - Intergenic
1118473079 14:66093424-66093446 GCTAAGAGCTGAACACTCGTTGG - Intergenic
1119036243 14:71232188-71232210 GCTGAGAGCTGAACACTCATCGG + Intergenic
1119613607 14:76083896-76083918 ACTGAAAGCTGTTCACTTCTCGG + Intronic
1121553312 14:94818823-94818845 GCTGAGAGTTGAACACTTGGCGG - Intergenic
1122034420 14:98937034-98937056 GCTGCAAGCTGGAGAAGTGTGGG + Intergenic
1124515651 15:30365561-30365583 CCTGAGAGCTGGAGGCTTGTTGG - Intronic
1124727270 15:32165163-32165185 CCTGAGAGCTGGAGGCTTGTTGG + Intronic
1125718200 15:41831675-41831697 GCTGAGAGCTGAACACTCGTTGG + Intronic
1125862106 15:43008880-43008902 ACTGAGTGCTGGACACTTGTTGG + Intronic
1126156841 15:45573936-45573958 GCTGAGAGCTGCACACTCGATGG - Intergenic
1126499653 15:49331184-49331206 TCTGAATGCTGGACAATTGGAGG - Intronic
1128401725 15:67289479-67289501 TCTCCAAGCTGGATACTTGTGGG - Intronic
1130738124 15:86571470-86571492 ACTAAGAGCTGCACACTTGTTGG - Intronic
1131768249 15:95704934-95704956 CCTGAAAGCTGGACATGTATTGG + Intergenic
1133398128 16:5464663-5464685 GCTGAATGCTGGAGACATGATGG - Intergenic
1133474091 16:6103062-6103084 GATCGAAGTTGGACACTTGTTGG + Intronic
1133602927 16:7357483-7357505 GCAGTAAGCAGGACAGTTGTAGG - Intronic
1134635201 16:15786571-15786593 GCTGCAAGCTGGAGACCGGTTGG + Intronic
1135057041 16:19240377-19240399 GCTGAGAGCTGAACACTCGTTGG - Intronic
1135421768 16:22309607-22309629 CCTGAAAGCTAGACACCTGTGGG + Intronic
1137256459 16:46778845-46778867 GCTGAGAACTGAACACTTGGTGG + Intronic
1137343944 16:47637137-47637159 GCTGAGAGCTGGACACTCATCGG + Intronic
1137588690 16:49680232-49680254 GCTGAGAGCTGGGCACTTGTTGG + Intronic
1138033497 16:53579884-53579906 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1138414834 16:56865671-56865693 GCAGAAATCTGGGCACATGTTGG + Intronic
1139150999 16:64381637-64381659 GCTGAGAGTTGGACACTCATTGG + Intergenic
1139219001 16:65159544-65159566 GCTGAAAGCTGGAGACAAGTAGG - Intergenic
1141331399 16:83114715-83114737 GCAGAAAGTTGGATATTTGTTGG + Intronic
1142050848 16:87957247-87957269 GCTGTAAGCTGGCGACCTGTGGG - Intronic
1144060894 17:11582837-11582859 GCTGGGAGCTGAGCACTTGTTGG - Intergenic
1144553370 17:16260639-16260661 TCTGACAGCTGGATACTCGTTGG + Intronic
1144667562 17:17112347-17112369 GCTGTGAGATGGGCACTTGTGGG - Intronic
1144695519 17:17301515-17301537 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1144695527 17:17301573-17301595 GCTGAAAGCTGAACACTTGTGGG + Intergenic
1146359223 17:32160262-32160284 GCTGAGAACTGAACACTTGTTGG + Intronic
1146606603 17:34263737-34263759 GATTAAAGCTGGACCCTTGCTGG - Intergenic
1148386248 17:47237220-47237242 GCTGAGAGCTGAACACTTATTGG - Intergenic
1149362444 17:55910250-55910272 GCTAGGAGCTGAACACTTGTTGG - Intergenic
1149884698 17:60328291-60328313 GCTGAGAGCTGGACAGATGATGG + Intronic
1150201447 17:63361889-63361911 GGTGAGAACTGGACACTTGCAGG - Intronic
1150201457 17:63361959-63361981 GCTGAGGGTTGTACACTTGTCGG - Intronic
1150201467 17:63362029-63362051 GCTGAGGGCTGCACACTTGATGG - Intronic
1150201478 17:63362099-63362121 GCTGAGGGTTGCACACTTGTTGG - Intronic
1150521081 17:65866713-65866735 GCTGAGAGCTGAACACTCATTGG + Intronic
1151256270 17:72879137-72879159 CCTGATAGCTGAACACTTGGAGG - Intronic
1151895197 17:76975285-76975307 GCTGATTGCTGAACACTTGATGG + Intergenic
1153139313 18:1954227-1954249 GCTGAACGCTGAACACTGGTTGG - Intergenic
1153139319 18:1954285-1954307 GCTGAGAGCTCAACACTCGTGGG - Intergenic
1153724017 18:7936974-7936996 GCTGAGTGCTAAACACTTGTTGG + Intronic
1154383894 18:13876187-13876209 GCAGAATGCTGGCCACGTGTGGG + Intergenic
1156160405 18:34351483-34351505 GCTGAGAGCTGAACACTTGATGG + Intergenic
1156298739 18:35817486-35817508 GCTGAGAGCTGAACACTTCATGG - Intergenic
1156327312 18:36085796-36085818 GCTGGGAGCTGAACACTTGTTGG + Intergenic
1156880142 18:42067815-42067837 ATTGAAACTTGGACACTTGTTGG + Intronic
1157367877 18:47082894-47082916 AATGAAAGCAGGACACTAGTGGG - Intronic
1157370221 18:47104010-47104032 TCTGAAAGGTGGAAACTGGTTGG - Intergenic
1157829197 18:50840828-50840850 TCTGAGAGATGGACACTGGTGGG - Intergenic
1158139422 18:54241559-54241581 GCTGAGAGCTGAACACTCATTGG - Intergenic
1158198029 18:54910194-54910216 GTTGATAGCTGAACACTTGTTGG - Intronic
1159018701 18:63125043-63125065 GGTGAAAGCTAGACATGTGTTGG + Exonic
1159522592 18:69545225-69545247 TCTGAAAGCTGGGAACTTGAAGG + Intronic
1160156077 18:76434741-76434763 GCTGGAAGCTGGACACTAACAGG + Intronic
1160470548 18:79128918-79128940 GCTGAGATCAGGACAATTGTGGG - Intronic
1160943126 19:1629332-1629354 GCTGAATGCTGGGCACTTTGGGG - Intronic
1161757301 19:6143599-6143621 GGTGTCACCTGGACACTTGTGGG - Intronic
1162097627 19:8320479-8320501 TCTGAAATCAGGACACTTCTGGG + Intronic
1165022693 19:32936882-32936904 GCTGAGAGCTGAACACTTAACGG + Intronic
1165366405 19:35369791-35369813 GCTCACAGCTTGACAATTGTTGG - Intergenic
1166897524 19:46033150-46033172 GTTGAGAGCTGGACACTTGTTGG + Intergenic
1167013216 19:46822351-46822373 GCTGAGAGCTGAACACTCGATGG + Intergenic
1167051862 19:47084313-47084335 GCTGAAAGCTGGGCACCTCTAGG - Intronic
1202659099 1_KI270708v1_random:51707-51729 GCTGAGAGCTGAACAGATGTTGG - Intergenic
924963914 2:58207-58229 GCTGAGAGCTGAACACTCGATGG + Intergenic
925515360 2:4675038-4675060 GCTGAGAGCTGAGCACCTGTTGG + Intergenic
926181769 2:10651109-10651131 GCTGGAGGGTGGACTCTTGTGGG - Intronic
926718931 2:15944205-15944227 CCGGAAAGCTGAACAATTGTGGG - Intronic
926958797 2:18332026-18332048 GCTGAGAACTGAACACTTGTTGG - Intronic
926976513 2:18521457-18521479 GCTGAAACCTGGAAACTTTCAGG - Intergenic
927613530 2:24566242-24566264 GCTGAAAGCTGAGCACTCATCGG - Intronic
928723554 2:34147215-34147237 GCTGAGAGCTGGACACTCAACGG - Intergenic
928823485 2:35391525-35391547 GCTGAGAGCTGGACCCTGGTTGG - Intergenic
928840517 2:35599403-35599425 GCTGAAAGCTGAGCAGATGTTGG + Intergenic
928840990 2:35604442-35604464 TTTGAAATCTGGACACTTGATGG - Intergenic
929014610 2:37481922-37481944 GCTGAGAGCTTAACACTTGTTGG + Intergenic
929492505 2:42408566-42408588 GCTAGGAGCTGAACACTTGTTGG + Intronic
929847090 2:45541601-45541623 GCTGAGAGCTAGACACTCATTGG - Intronic
930064812 2:47319790-47319812 GCTGAAAGATGGATACTTCTGGG - Intergenic
930612065 2:53554554-53554576 GCTGAGAGCTGAACACTCTTTGG + Intronic
930729049 2:54709871-54709893 GCTGAGAGCTGAACACTCATTGG + Intergenic
931300536 2:60974111-60974133 GCTGAGAGCTGAACACTTATCGG + Intronic
932054683 2:68432399-68432421 GCTGAGAGCTGAACACTCCTCGG - Intergenic
932214525 2:69958357-69958379 GCTGAGAGCTGGAGACCTGGGGG + Intergenic
936274075 2:111077929-111077951 TCTGAAACCTGCACATTTGTGGG + Intronic
936768158 2:115878700-115878722 GCAGAAAGGTGGACATTTATAGG + Intergenic
937167846 2:119837333-119837355 ACTGAGGGCTGGACACTTGTCGG + Intronic
939167755 2:138657549-138657571 GCTGAAAGCTGGGCAATTGATGG + Intergenic
939894309 2:147773344-147773366 GATGAAAGGTTGACACATGTGGG - Intergenic
940024734 2:149193948-149193970 TCAGAAAGATGGACACATGTTGG - Intronic
940956925 2:159738575-159738597 ACTGAAAGCTACACACTCGTTGG - Intronic
941043657 2:160649353-160649375 GCTGAGAGCTGAACACTCGTCGG + Intergenic
941151442 2:161919561-161919583 GCTGAGAGCTGCACACTTGATGG + Intronic
941404852 2:165075074-165075096 GCTGAGAGCTGGACACTTGTTGG + Intergenic
943023430 2:182601680-182601702 GCTGAAGGCTGAACACTCGTTGG - Intergenic
943191050 2:184680266-184680288 GCTGAGAGCTGAACAGATGTGGG + Intronic
943676618 2:190721850-190721872 CCTGAAAGCTGAACACATGGAGG + Intergenic
943820371 2:192314474-192314496 GCTGATAGCTGAACACTTGTCGG - Intergenic
943928466 2:193819437-193819459 TCTGAGAGCTGGACACTCTTTGG - Intergenic
943965612 2:194328231-194328253 GCTGAGAGCTAGACTCTGGTTGG + Intergenic
944038494 2:195327045-195327067 CATGAAAACTGGACACATGTGGG - Intergenic
944938529 2:204596262-204596284 GCTGGATGATGGATACTTGTGGG - Intronic
945507521 2:210659517-210659539 GATGGAAGCTGGAGACTAGTGGG - Intronic
946197419 2:218043467-218043489 GCTGAGAGCTGAACAGATGTTGG - Intronic
946495627 2:220192699-220192721 GCTGAGAACTGGACACTCATTGG + Intergenic
947054777 2:226087800-226087822 TCTGAAAGCTGGACACTCATTGG - Intergenic
1168902423 20:1376267-1376289 GCGTAAAGCTGGCCCCTTGTAGG + Intronic
1170004214 20:11647373-11647395 GCTGAGAGCTGAACACTCATTGG + Intergenic
1170327885 20:15176548-15176570 GCTGAGAGCTGGACACTCTTAGG + Intronic
1171286043 20:23938690-23938712 ACTGAGAGCTGGACACTCCTGGG + Intergenic
1172624262 20:36338182-36338204 GCTGAGAGCTGGGCACTGGCAGG + Intronic
1174483954 20:50849726-50849748 GGAGAAAGCTGGACATTTGGAGG + Intronic
1175001321 20:55633204-55633226 GCTAGGAGCTGAACACTTGTTGG - Intergenic
1175064399 20:56272778-56272800 GCTGAGAGCTGAACACTCTTTGG + Intergenic
1175131643 20:56794000-56794022 GAAGAAAACTGGACACATGTTGG - Intergenic
1175675863 20:60946062-60946084 GCTGCGAGCTGAACACTTGATGG + Intergenic
1176408456 21:6434571-6434593 ACTGATAGCTGAACACTTGTTGG + Intergenic
1176613050 21:9003663-9003685 ATTGAAATCTTGACACTTGTTGG - Intergenic
1176938223 21:14892320-14892342 GCTGAAAGCTGGACCTTGGGTGG + Intergenic
1176976551 21:15327527-15327549 GCTATGAGCTGAACACTTGTTGG + Intergenic
1178040000 21:28629777-28629799 GCGGAAACCTGGATACTGGTAGG - Intergenic
1178937440 21:36875449-36875471 GCTGAGAGCTGGACACATGTCGG + Intronic
1179683949 21:43042897-43042919 ACTGATAGCTGAACACTTGTTGG + Intergenic
1180378177 22:12113993-12114015 GCTGAGAGCTGAACAGATGTTGG - Intergenic
1181475224 22:23163960-23163982 GCTAAAAGCTGGACACAAGCCGG - Exonic
1184865797 22:47201347-47201369 GCAGATAGCTGAACATTTGTCGG - Intergenic
1184869400 22:47225769-47225791 GCTGATATCTGAACACTTGTTGG - Intergenic
949268124 3:2184407-2184429 CTTGAAACCTAGACACTTGTTGG + Intronic
950207635 3:11092742-11092764 GCTGACAGTTGAACACTTGTTGG + Intergenic
951136173 3:19106945-19106967 GCTGATAGCTGAACAGTTGTTGG - Intergenic
951182245 3:19672106-19672128 GCTGAGAGCTGAACACTCATTGG - Intergenic
951508863 3:23479744-23479766 GCTGAGAGCTGGACATTCATTGG - Intronic
952016186 3:28959526-28959548 GCTGAGAGCTGAACACTTGATGG + Intergenic
952408587 3:33026806-33026828 GCTGAGAGCTGAACACTCGCTGG + Intronic
953603102 3:44387193-44387215 GCTGAAAGCTGGACACTCGTGGG + Intronic
953748141 3:45590878-45590900 ACTGAGAGCTGGACACTCATCGG - Intronic
954099318 3:48357396-48357418 GCAGACAGCTGAACACTTGATGG - Intergenic
954461236 3:50628152-50628174 TCTGAAAGCTGGAGAGTTTTGGG + Intronic
955111854 3:55958170-55958192 GCTGAGAGCTGAACACTCATTGG - Intronic
956238080 3:67097393-67097415 GTTGAAACCTGAACACTTATTGG - Intergenic
956462261 3:69484575-69484597 GCTGAGAGCTGAACACTTGATGG - Intronic
956658483 3:71576633-71576655 GCTTAAAGCTGCTCAGTTGTAGG - Intronic
957404057 3:79754367-79754389 GCAGGGAGCTAGACACTTGTAGG - Intronic
957427069 3:80052013-80052035 GCTGAGAGCTGAACACTCATGGG + Intergenic
957788004 3:84905693-84905715 GCTGAGAGCTGGACACTCATTGG + Intergenic
958141769 3:89571224-89571246 GCTGAGAGCTGGACACTCATTGG - Intergenic
958195370 3:90236096-90236118 GCTGAGAGCTGAACACTTGATGG + Intergenic
958418789 3:93907511-93907533 GCTGAGGGCTGAACACTTGATGG + Intronic
958498368 3:94874619-94874641 GCTGAGAGCTGGACACTCTTTGG - Intergenic
958678152 3:97293161-97293183 GCTGAGAGCTGGACGCTTGCTGG - Intronic
958678171 3:97293295-97293317 GCTGAGAGCTGGACACTCACTGG - Intronic
959897133 3:111617586-111617608 ACTGAGAGCTGGACACTCATTGG + Intronic
960333898 3:116392946-116392968 GCTGAGAGCTGGACACTTGATGG + Intronic
960690651 3:120342590-120342612 GCTGAGAGCTGAACACTTGAAGG + Intronic
962105210 3:132382750-132382772 GCTGATAGCTGAATACTTGTTGG - Intergenic
962399711 3:135047965-135047987 GATGAAAGATGGACATTTGTGGG + Intronic
962824497 3:139088233-139088255 ACTGATAGCTGAACACTTATTGG - Intronic
963358719 3:144243135-144243157 GCTGAAAGCAGGGCAATTATTGG - Intergenic
963483394 3:145904553-145904575 GCTGATAGCTGAACACTTGTTGG + Intergenic
963805198 3:149714993-149715015 GCTGACAGCTGAAAACTCGTCGG + Intronic
964075168 3:152684381-152684403 TCTGAGAGCTGGACACTCATTGG - Intergenic
964548536 3:157861253-157861275 GGTGAAAGCTGGAAACTGTTGGG + Intergenic
964590662 3:158359998-158360020 GCTGAGAACTGAACACTTGTTGG - Intronic
965165184 3:165188352-165188374 GCTGGGAGCTGGACACTGCTAGG + Exonic
965367807 3:167821020-167821042 GCTAAGAGTTGGACACTCGTTGG + Intronic
965793046 3:172410629-172410651 TCTGAGAGCTGAACACTTGAGGG - Intergenic
965984617 3:174736447-174736469 GCTGATAGCTGAACACTTGTTGG - Intronic
966193764 3:177294207-177294229 GCTGAAAGCCAGACACTAGAAGG + Intergenic
967743356 3:193027563-193027585 GCTGCGAGATGGGCACTTGTAGG - Intergenic
971092456 4:23361104-23361126 ACTGAGAGCTGGACGCTTGTGGG + Intergenic
971851007 4:31986415-31986437 GCTGAAAACAGGAAACTTATTGG - Intergenic
971876802 4:32318668-32318690 GCTGAGAGCTGGACACTCATTGG - Intergenic
973041202 4:45472178-45472200 GCTGATGGCTGAACACTTGTTGG + Intergenic
974619901 4:64341104-64341126 GCTAAGAGCTGAACACTTGTTGG + Intronic
974894902 4:67926995-67927017 GCTAGGAGCTGGACACTTGTTGG + Intronic
975044447 4:69783949-69783971 GCTAGGAGCTGAACACTTGTCGG + Intronic
975254325 4:72216075-72216097 GCAGAAAGCTGGACACTCATTGG - Intergenic
975913703 4:79298066-79298088 GCTGGGAGCTGAACACTTGTTGG + Intronic
976129724 4:81871243-81871265 GCTGAGAACTGAACACTTGTCGG + Intronic
976700825 4:87966860-87966882 GCTGAGAACTGAACACTTTTCGG + Intergenic
976921416 4:90449039-90449061 GCTGAGAGCTGAACAGATGTTGG - Intronic
977359128 4:95981356-95981378 GCCGATAGCTGAACACTTGTTGG + Intergenic
977487288 4:97665412-97665434 GCTGAGAGCTGAACACTTGTTGG - Intronic
978192647 4:105932794-105932816 GCTGAAGGCTGGACACTCCTGGG - Intronic
978229867 4:106385614-106385636 GCTAATAGCTGAACACTTGTTGG - Intergenic
978301027 4:107269951-107269973 GCTGAGAGCTGGACACTTGTTGG - Intronic
979637882 4:122978109-122978131 GCTGAGAACTGGACACTAGCTGG - Intronic
980007630 4:127559618-127559640 GCTGGAAGCTAAACACTTGTTGG + Intergenic
980180285 4:129393034-129393056 GCTAGGAGCTGGACACTTATCGG + Intergenic
980450260 4:132960069-132960091 GCTGAGAGCTGAACACTTATTGG + Intergenic
980574337 4:134666085-134666107 GCTGAGAGCTGAACACTCATGGG - Intergenic
980744992 4:137001311-137001333 GCTGAAAGCTGAACATTCATTGG + Intergenic
982158016 4:152540330-152540352 GCTGAGAACTGAACACTTGTTGG - Intergenic
982181499 4:152752041-152752063 ACTGAGAGCTGGACACTCATTGG + Intronic
982802558 4:159722752-159722774 GCTGAGAGCCAGACACTCGTTGG - Intergenic
983129664 4:164001617-164001639 GCAGAAAGCTGGAAAATTGTAGG - Intronic
983380072 4:166981122-166981144 GCTGAAAGCTGGACACTTGTTGG - Intronic
983380105 4:166981322-166981344 GCTGAGAGCTGGACACTTGTTGG - Intronic
983380115 4:166981392-166981414 TCTGAGAGCTGGACACTCATTGG - Intronic
983715489 4:170776659-170776681 GCTGAGAGCTGAGCACTCGTTGG + Intergenic
984296680 4:177862272-177862294 ACTGAGAGCTGGACACTTGCTGG + Intronic
984325244 4:178242341-178242363 TCTGAGAGCTGAGCACTTGTTGG + Intergenic
984763830 4:183384497-183384519 GTTGAGAGCTGGACACTCATTGG + Intergenic
985765699 5:1778310-1778332 GCTGAAAGCTGGGGGCCTGTGGG + Intergenic
986969095 5:13311228-13311250 GCTGGAAGATGGTCAGTTGTGGG - Intergenic
987027328 5:13940501-13940523 GCTTAAAGCTGGCCACTCATTGG + Intronic
987951909 5:24687101-24687123 GCTGAAGGCTGAGCACTTATTGG - Intergenic
989821717 5:45800815-45800837 TCTGAGAGCTGGACATTTGTTGG + Intergenic
991527223 5:67574089-67574111 GCTGAGATCTGCACACTTGTTGG + Intergenic
992591766 5:78302940-78302962 GCTGAAAGCAAGACATTTTTTGG + Intergenic
992693077 5:79259066-79259088 GCTGAAAGCTGAACACTCATCGG - Intronic
992693090 5:79259180-79259202 TCTGAGAGCTGGACACTCGTCGG - Intronic
993037521 5:82773870-82773892 GCTGGACGCAGGAGACTTGTAGG - Intergenic
993958176 5:94263070-94263092 CCTGAAAGCTGGACAGTTTGGGG - Intronic
995146051 5:108787717-108787739 GCTGAGAGCTGGATGCTTGTTGG + Intronic
995386652 5:111596300-111596322 ACTGAGAGCTGGACACTTATTGG + Intergenic
995927052 5:117386705-117386727 ACTGAGAGCTGGGCACTTGTTGG + Intergenic
1000084929 5:157880575-157880597 GCTAAATGCTGGGCACCTGTCGG + Intergenic
1002103667 5:176869505-176869527 GCTGTGAGCTGGACACGGGTGGG - Intronic
1002986263 6:2192185-2192207 GCTGACAGCTGAACACTTGTTGG + Intronic
1003455483 6:6277943-6277965 GCTGAAAGGTGGGCACTTCAAGG - Intronic
1004287456 6:14335069-14335091 CCTGAAAGCAGGACATTTGGTGG + Intergenic
1005445228 6:25915813-25915835 GCTGCAAGCTGTACAATTTTAGG - Exonic
1008231637 6:48990414-48990436 GATGAGAGCTGGACACTCATCGG + Intergenic
1009382541 6:63050290-63050312 CCTGAAAGCTGACCACTTCTGGG + Intergenic
1010534622 6:77011808-77011830 ACTGAGAGCTGGACACTCATTGG + Intergenic
1011437163 6:87350846-87350868 GCTGAAAGCTGCAGTCATGTGGG - Intronic
1011795600 6:90948200-90948222 GCTGGGAGCTGAACACTTGTCGG + Intergenic
1012709594 6:102582219-102582241 ACTGAGAGCTGGACACTCATTGG + Intergenic
1013438545 6:110138591-110138613 GCTGAGAGCTGGACACTCATTGG - Intronic
1015143351 6:129959171-129959193 GCTGAGAGCTGAACACTCATGGG + Intergenic
1015470717 6:133603113-133603135 GTTGAAGGCTGCACACTTTTTGG - Intergenic
1016210871 6:141531826-141531848 GCTGAGAGCTGGACACTAGCTGG + Intergenic
1019035940 6:169058747-169058769 TCTGGAAGGTGGACACTTGCAGG + Intergenic
1019897887 7:3997444-3997466 GCTGACAGCTGAACACTTGTCGG - Intronic
1020474807 7:8582499-8582521 GCTGAGAGCTGGACACTCGTCGG - Intronic
1021097284 7:16548119-16548141 GCTGAGAGCTGGACACTTGTTGG + Intronic
1021269991 7:18574209-18574231 ACTGAAAGCTGGACACGTGTTGG - Intronic
1021561350 7:21971775-21971797 GCTGACAGCTGAACACTCGAAGG - Intergenic
1022423399 7:30245724-30245746 GCTGAGAGCTGAACACTCATTGG - Intergenic
1023790396 7:43749417-43749439 GCTGAGAGCTGGACACTCCATGG - Intergenic
1026391998 7:69911632-69911654 ACTGAGAGCTGGACACTCATAGG - Intronic
1027779809 7:82507431-82507453 GCTGGTAGCTGAACACTTGTGGG - Intergenic
1029973732 7:104814192-104814214 GCTGATAGCTGAACACTTGTTGG - Intronic
1030243906 7:107360234-107360256 ACTAAGAGCTGGACACTTGTGGG + Intronic
1030484453 7:110148756-110148778 GCTGAGAGCTCAACACTTGTCGG - Intergenic
1031242030 7:119258014-119258036 GCTGAGAGCTGAACACTTGAAGG - Intergenic
1032617665 7:133492518-133492540 GCTGAAAGCCTTACACTTGAGGG - Intronic
1032658298 7:133955373-133955395 GCTGAGAGCTGAACACTTGACGG - Intronic
1034210366 7:149357922-149357944 GCTGAAAGCTGAACACTCATCGG - Intergenic
1035037898 7:155907281-155907303 ACAGCAGGCTGGACACTTGTGGG + Intergenic
1036696409 8:10977968-10977990 CCTGAAAGCTGGAGACATGTGGG - Intronic
1039210113 8:35204332-35204354 ACTGAGAGCTGGACACTCATTGG - Intergenic
1040000008 8:42567666-42567688 GCTAAATACTGGACACCTGTTGG - Intergenic
1040725608 8:50378744-50378766 GCTGAGAACTGAACACTTCTTGG - Intronic
1041205464 8:55494606-55494628 GCTGAGAGCTGAACACTCGTTGG - Intronic
1041432775 8:57802687-57802709 CCTGCACGCTGAACACTTGTTGG + Intergenic
1042625151 8:70749054-70749076 GCTGAGAGCTGGACATTCATCGG + Intronic
1042687829 8:71461888-71461910 GCTGCGACCTGAACACTTGTTGG - Intronic
1043695220 8:83208690-83208712 GCTGACAGCTGGACACTAGTTGG + Intergenic
1043734185 8:83723853-83723875 GCTGAGAGCTGAACACTCATTGG - Intergenic
1044053719 8:87542421-87542443 GCTGAGAGCTGGACACTCATTGG - Intronic
1044259100 8:90097607-90097629 GCTGAGAGCTGAACACTCGACGG - Intergenic
1044409601 8:91868534-91868556 GCTGAGAGCTGAACACTTCTTGG + Intergenic
1044736336 8:95282894-95282916 GTTGAAAGCTGGAAACTTCCAGG - Intergenic
1044962383 8:97543187-97543209 GCTGAGAGCTAAACACTTGACGG + Intergenic
1045030669 8:98132418-98132440 GCTGAGAGCTGGTCACTGGATGG + Intronic
1046849301 8:118954195-118954217 GCTGTAAGCTGGAGACAGGTTGG + Intergenic
1048421666 8:134283845-134283867 GCTGATAGCTGGACACCTGTTGG - Intergenic
1049021796 8:139962062-139962084 GCTGAGAACTGAACACTTGAAGG + Intronic
1049801670 8:144520631-144520653 GCTGGAAGCGGGCCACGTGTGGG - Exonic
1050095124 9:2056922-2056944 ACTGAAAAATGGACCCTTGTGGG + Intronic
1051697264 9:19782047-19782069 GCTTAAAGCTGGATAGTTGGAGG - Intronic
1052466765 9:28839464-28839486 GCTGAGAGCTGCATACTTGATGG - Intergenic
1052609835 9:30758534-30758556 TCTGAGAGCTGGACACTTGTCGG - Intergenic
1052623554 9:30944568-30944590 ACTAAGAACTGGACACTTGTTGG + Intergenic
1053445095 9:38146536-38146558 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1053649121 9:40145861-40145883 ATTGAAATCTTGACACTTGTTGG + Intergenic
1053756622 9:41318023-41318045 ATTGAAATCTTGACACTTGTTGG - Intergenic
1054535460 9:66230312-66230334 ATTGAAATCTTGACACTTGTTGG - Intergenic
1057468598 9:95337998-95338020 GCTGATAACTGAACACTTGTTGG + Intergenic
1057516552 9:95726865-95726887 GCTGAAGGTTGGACAGTTGTTGG + Intergenic
1058091978 9:100814751-100814773 GCTGAGAGCTGAGCACTTGATGG + Intergenic
1060618826 9:125044406-125044428 GCTGAGAGCTGGACACTTGCTGG + Intronic
1062173626 9:135148883-135148905 GCAGCAAGCTGGACACTAGAGGG + Intergenic
1203784988 EBV:122638-122660 GCTGAAGGCTGGCCCGTTGTAGG + Intergenic
1185910519 X:3976549-3976571 CCAGAGAGCTGAACACTTGTAGG + Intergenic
1186850469 X:13574863-13574885 CCTCAAAGCTGTACAATTGTTGG - Intronic
1187238303 X:17488553-17488575 GGTGAAATCTGGACTCTTCTCGG + Intronic
1187871185 X:23766640-23766662 ACTGAGAGCTGGACACTTACTGG - Intergenic
1188194956 X:27222254-27222276 GCTGAGAGCTGGACAAATGTTGG + Intergenic
1188194968 X:27222324-27222346 GTTGAGAGCTGGACACTTATTGG + Intergenic
1188434934 X:30148860-30148882 ACTGAGAGCTGGACACTCATCGG + Intergenic
1190369539 X:49727532-49727554 GCTGAGAGCTGAGCACTTGTTGG + Intergenic
1190475742 X:50825628-50825650 GCTGAAAGATGGCCTCTTCTGGG + Intergenic
1190621137 X:52288012-52288034 ACTGAGAGCTGGACACTCATTGG + Intergenic
1190621156 X:52288149-52288171 TCTGACAGCTGGACACTTGTTGG + Intergenic
1190621168 X:52288216-52288238 GCTGCTAGCTAGACACTTGTTGG + Intergenic
1190621195 X:52288363-52288385 ACTGAAAGCTGGAAACTCGTTGG + Intergenic
1191016400 X:55814016-55814038 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1191221291 X:57990480-57990502 GCTGAGAGCTGAATACTTGATGG + Intergenic
1192321190 X:70091953-70091975 GCTGAAAGCTGTAGACTTGGAGG - Intergenic
1192870363 X:75178259-75178281 GCTAAAAACTGGGCACCTGTCGG - Intergenic
1193108382 X:77703850-77703872 GCTAGGAGCTGAACACTTGTTGG - Intronic
1193467610 X:81867925-81867947 GCTGAGAACTGAACACTTGTTGG - Intergenic
1193818748 X:86136481-86136503 GCTGAAAGCTGTGCAGTTCTAGG - Intergenic
1194212242 X:91082860-91082882 GCTGAGAGCTGGACACTGATTGG + Intergenic
1195178498 X:102333900-102333922 GCTGATAGCTGAACACTTGTCGG - Intergenic
1195180366 X:102353183-102353205 GCTGATAGCTGAACACTTGTCGG + Intergenic
1195655064 X:107325120-107325142 GCTGGGAGCTGAACACTTGTGGG + Intergenic
1198660498 X:138963243-138963265 GCTGAGAGCTGTCCACCTGTGGG - Intronic
1199187961 X:144939171-144939193 GCTGAGAGCTGAAAACTTGTTGG - Intergenic
1199187968 X:144939229-144939251 GCTGAGAGCTGAATGCTTGTTGG - Intergenic
1199614835 X:149648092-149648114 GCTAGGAGCTGAACACTTGTTGG + Intergenic
1200424833 Y:3009270-3009292 GCTGAAAGGTGGACACTCATTGG - Intergenic
1201982817 Y:19925871-19925893 CATGAAAGGTGGACTCTTGTGGG + Intergenic
1202137531 Y:21682543-21682565 GCTGAGAGATGGACACTCATCGG - Intergenic