ID: 983380076

View in Genome Browser
Species Human (GRCh38)
Location 4:166981143-166981165
Sequence GCCCAGAGGAGACCCATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983380071_983380076 19 Left 983380071 4:166981101-166981123 CCTTTCTGCAGGCAGGTCGTTCC 0: 1
1: 10
2: 73
3: 269
4: 553
Right 983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG No data
983380072_983380076 -2 Left 983380072 4:166981122-166981144 CCAACAAGTGTCCAGCTTTCAGC 0: 1
1: 15
2: 34
3: 116
4: 281
Right 983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983380076 Original CRISPR GCCCAGAGGAGACCCATAGT GGG Intronic
No off target data available for this crispr