ID: 983381482

View in Genome Browser
Species Human (GRCh38)
Location 4:167000285-167000307
Sequence CTCTGCAGTTATTCCTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983381480_983381482 -10 Left 983381480 4:167000272-167000294 CCAAATATTTATACTCTGCAGTT 0: 1
1: 0
2: 3
3: 55
4: 381
Right 983381482 4:167000285-167000307 CTCTGCAGTTATTCCTGGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983381482 Original CRISPR CTCTGCAGTTATTCCTGGTA AGG Intronic
904348831 1:29891824-29891846 CTCTGCTGTGTTCCCTGGTATGG + Intergenic
906081418 1:43091336-43091358 CTCAGCAGGTATCCCTGGTGGGG + Intergenic
906186797 1:43868573-43868595 CTGGGCAGTTCTTCCTGGAAAGG + Intronic
907687630 1:56628875-56628897 CTCTGAAGGTATTCCCAGTAAGG - Intronic
908516321 1:64896420-64896442 CTATGCTTTTATTCCTGGGAAGG - Intronic
911722789 1:101209583-101209605 CTCTGAAATTATTCTTGGAATGG - Intergenic
913090634 1:115474460-115474482 CTCTGCAGAAATTCCAAGTAAGG + Intergenic
913333273 1:117684853-117684875 CACTGCAGTGATTGCTGGTGTGG + Intergenic
917870076 1:179233490-179233512 CTCTGCAGTAATTCCAGTGAGGG + Intergenic
919575858 1:199308865-199308887 CGTTGCAGTTATTGCTGGGAAGG - Intergenic
920185621 1:204157355-204157377 CTCTGCAGAGATTCCGAGTAAGG - Exonic
920843595 1:209575456-209575478 CTCTGCTGTTGTTCCTGAGATGG - Intergenic
1063702361 10:8397345-8397367 CTCTGCAGTTATAACTGATGTGG + Intergenic
1070638011 10:78144809-78144831 CTCTGCAATTACTGCTGGTTTGG + Intergenic
1071481961 10:86071300-86071322 CTGTGCAGTTATACCAGGTGGGG - Intronic
1071483868 10:86085200-86085222 CTCTCCAGCTATTCCTGGAGGGG - Intronic
1074273755 10:111981339-111981361 CTCTGTAGTTTTCCCTGGCAGGG - Intergenic
1076060139 10:127407697-127407719 ATCTGCAGTCATTCCTGGACAGG - Intronic
1076260813 10:129064280-129064302 ATCAACAGTTATTCCTGGTAAGG + Intergenic
1079569126 11:21921188-21921210 CTCTCCAGTTATTCATGAGAGGG + Intergenic
1079631570 11:22684076-22684098 CTATGCTTTTGTTCCTGGTATGG - Intronic
1079836234 11:25337627-25337649 CTCTTCATTTATTACTGATAAGG + Intergenic
1086318583 11:85619851-85619873 CTCTCCATATATTACTGGTATGG + Intronic
1087825220 11:102757230-102757252 CTCTGCCGTTCTTTCTGTTAAGG + Intergenic
1088994832 11:114987256-114987278 CTCTGCAGATATTTCTTGTACGG + Intergenic
1091620716 12:2086607-2086629 CAGTGCAGTTACTCCTGGTCAGG + Intronic
1092097005 12:5851018-5851040 TTCTGCAGTTATTCGTTGTGTGG - Intronic
1094049803 12:26206532-26206554 CTCTGCAGTCATTTCTAGAATGG + Intronic
1095523503 12:43096442-43096464 CTCTGCAGCTATTGCAGGCAAGG + Intergenic
1096052038 12:48618811-48618833 CTCTCCACTTCTTCCTGGGAAGG - Intergenic
1097976803 12:65695310-65695332 CTTTGCAGTTAGTGATGGTAAGG + Intergenic
1100177718 12:92050005-92050027 CTTTGCAGCTATTTCTGGCAAGG - Intronic
1101362993 12:104045222-104045244 CTCTGCTTTTATTCCTGGAGTGG - Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103196472 12:119047862-119047884 CTTTGCAGTTCTTCCTACTAGGG - Intronic
1103816290 12:123659568-123659590 TTCTGCAGTATTTGCTGGTAAGG + Exonic
1105255359 13:18740886-18740908 CTCTGCAGATGTACCTGGCAGGG - Intergenic
1106424393 13:29611858-29611880 CTCTGGTGTTACTCCAGGTAGGG + Intergenic
1109295988 13:60531168-60531190 ATCTGCTGGTATTCCTGGGAAGG - Intronic
1113518534 13:110921477-110921499 TTCTGCCGATATTCCTGGGAGGG + Intergenic
1114207314 14:20584560-20584582 CCTGACAGTTATTCCTGGTAGGG + Intronic
1118055452 14:62075004-62075026 TTCTGCAGGTATTATTGGTATGG + Intronic
1119318065 14:73712587-73712609 TTCTGCAGTTAGGCCTGGAAGGG - Exonic
1125470074 15:39993808-39993830 CTCTGCAGGAAGTCCTGGTAAGG + Intronic
1130126189 15:81095997-81096019 CTCTGAAGTTATTTCTGGTTGGG - Intronic
1130209247 15:81908247-81908269 CTCCGCAGCTGTTCCTGGTGAGG + Intergenic
1130536840 15:84791804-84791826 GTATGCTGTTATTCCTGGTCAGG - Intronic
1141295664 16:82766404-82766426 CTCTACAGTTATCCTTGGCAAGG - Intronic
1141587296 16:85043177-85043199 CTGTGTAGTTATTCCTTGTGAGG + Intronic
1143136004 17:4712592-4712614 CTCAGCAGTGATCCCTGGAAAGG - Intronic
1144362299 17:14507147-14507169 CTAAGTAGTTTTTCCTGGTATGG - Intergenic
1144703518 17:17353257-17353279 CTCTGGAGCTGTTCCTGGTTAGG + Intergenic
1146367708 17:32242152-32242174 TTCTTCAGTAATTGCTGGTAAGG - Intronic
1147205656 17:38835556-38835578 TCCTGCAATTATTCCTGGTGCGG - Intronic
1153846130 18:9051321-9051343 CTCTGCAGTTATGCAGGGTACGG - Intergenic
1153955826 18:10095269-10095291 CTCTGCAGTCCTTCCAGGAAGGG - Intergenic
1154435659 18:14339716-14339738 CTCTGCAGATGTGCCTGGCAGGG + Intergenic
1155777348 18:29781478-29781500 CTCAGCAGTCATTCCTGGTCTGG - Intergenic
1155889943 18:31255383-31255405 CTCTGCTTTTATCCCTGATAGGG - Intergenic
1157570307 18:48707918-48707940 CTCTGCAGATATGCCTATTATGG + Intronic
1159243777 18:65778381-65778403 CTGTGCAGTTTTTCCTGGTTTGG - Intronic
1165896142 19:39142470-39142492 CTCTGAAGTCACTCCTAGTAAGG + Intronic
1167263843 19:48473775-48473797 CTCAGCAGTTGTTTCAGGTATGG - Intronic
926859004 2:17288870-17288892 CTCTGCAGTTATACATTCTATGG + Intergenic
928227648 2:29467000-29467022 ATCTCCAGTTGTTTCTGGTAAGG + Intronic
928768040 2:34671210-34671232 CTCTGCTGATAATCCTGGTAAGG + Intergenic
929521402 2:42655107-42655129 CTCTGCAGAGATACCTGATAAGG - Intronic
930515543 2:52402589-52402611 TTCTGCAGTTCTTCCTAGGATGG + Intergenic
930537311 2:52659532-52659554 CTCTGAAGTTATTTTTTGTAAGG + Intergenic
932956544 2:76357498-76357520 CTCTGCTGCTATCCATGGTATGG - Intergenic
936538785 2:113333364-113333386 CTCAGCAGTGATTCCTGTCATGG + Intergenic
938930219 2:136080148-136080170 CTCTGCCATTGTTGCTGGTATGG - Intergenic
939648161 2:144727617-144727639 CTGTGCAGTATTTCCTTGTATGG - Intergenic
942338433 2:174916605-174916627 TTCTGGAGTTTTTCCTGATAGGG + Intronic
944444351 2:199774519-199774541 CTCTGCAGTTTTTAATGGTGGGG + Intronic
944498180 2:200329639-200329661 GACTGAAGTTATTCCTGATAGGG + Intronic
948567608 2:238896695-238896717 CCATGCAGTCATTCCTGGGAAGG + Intronic
1169277546 20:4243856-4243878 CTCTGCAGTTGTTCCTCACAGGG + Intronic
1169537456 20:6560554-6560576 CTCTGCAGTGAATTCTGGTGTGG - Intergenic
1170780652 20:19422652-19422674 GTCTGCAGTGAGTCCTGGCAGGG + Intronic
1170885229 20:20335073-20335095 CTCTGCAGTTAAGCCAGGTCGGG + Intronic
1175334665 20:58187418-58187440 CACTGCAAGGATTCCTGGTAGGG + Intergenic
1176841376 21:13845916-13845938 CTCTGCAGATGTACCTGGCAGGG - Intergenic
1177258786 21:18701274-18701296 GACTGCAGTTTTTCCTAGTATGG + Intergenic
1178928697 21:36797624-36797646 ATCTGCACTTATTCTTGGTGTGG + Intronic
1180868680 22:19134061-19134083 TTCTCCAGTGACTCCTGGTATGG + Exonic
1182577182 22:31280904-31280926 CTCTGCAGTTATTCCCCCTTTGG + Intergenic
1185236740 22:49718214-49718236 CTCTGCAGTCAGTGCTGGGAAGG + Intergenic
950295579 3:11827096-11827118 ATCTGCAGTTCTTCAGGGTATGG + Intronic
953443608 3:42942037-42942059 CTCTCCAGTCATTCCTGCTTAGG - Exonic
953679189 3:45026784-45026806 CTGTGCAGCTCTCCCTGGTAAGG - Intronic
956417936 3:69052580-69052602 CTTTGCAATTATTGCTGGCAAGG - Intergenic
960294676 3:115928643-115928665 CTCTGCAGTCTTTCCTGCCAGGG - Intronic
960707580 3:120495302-120495324 CTATTCAGTTATTCCTTTTATGG - Intergenic
962733075 3:138300598-138300620 CTCTGCAGTTCTTCCCTGGAGGG - Intronic
963458824 3:145579600-145579622 CTCTGCCATTATTCCTCTTAAGG + Intergenic
965729027 3:171750556-171750578 CTTTGCATTTATTCCTGTTTGGG - Intronic
966717552 3:183029113-183029135 CTCTGGAGTTATTACAGGTTTGG - Intronic
969879487 4:10161351-10161373 CTTTGCTGTTATTCTTGGGATGG - Intergenic
970100071 4:12511209-12511231 TTTTGCAGTTATTCTTTGTAAGG - Intergenic
970897067 4:21116657-21116679 ATCTGTAGTTATTCCTTGTTGGG + Intronic
975163357 4:71148891-71148913 CTCTGCATATATACCTAGTAAGG + Intergenic
976741013 4:88357662-88357684 CTTTTCAGTCATTCGTGGTATGG - Intergenic
980101998 4:128551126-128551148 TTCTGCAGTTCTCTCTGGTATGG - Intergenic
983381482 4:167000285-167000307 CTCTGCAGTTATTCCTGGTAAGG + Intronic
983807797 4:172017364-172017386 CTCTGCTGTTTTTCCAGGCATGG + Intronic
989357238 5:40557486-40557508 CTTTGCAGATATCCCTGCTATGG - Intergenic
993769452 5:91907094-91907116 CTCTGAAGTTATTCTTGATCTGG + Intergenic
996687805 5:126303310-126303332 CTCTTTAGTAATTCCTGGAAGGG - Intergenic
997241985 5:132314389-132314411 CTCAGCAGCTTTTCCTGGGAGGG + Intronic
999934018 5:156465431-156465453 TTCTACAGTTACTTCTGGTAAGG + Intronic
1000750725 5:165093430-165093452 CTCTGCTCTTGTTCCTGGTTTGG - Intergenic
1001044405 5:168360896-168360918 CTCTGCAGTTACTGCTGATGAGG + Intronic
1006609955 6:35288499-35288521 CTCTGTAGTCATTCCAGGAAGGG - Intronic
1006814913 6:36843587-36843609 CTGTGCAGGCATTCCTGGCAGGG + Intergenic
1021019626 7:15580425-15580447 CTTTGAAGTTATTTCTGCTAAGG - Intergenic
1026615362 7:71897799-71897821 CTCTGCTGTTTTTGCTGGTTTGG - Intronic
1027716513 7:81678023-81678045 CTCTGCTGATATTCCTGTGAAGG + Intergenic
1028434482 7:90786027-90786049 CAGTGCAGTTCTTCCTGGTACGG + Intronic
1030328959 7:108252552-108252574 TTCTGCAGCTATTTCTGGAAGGG - Intronic
1030581292 7:111359153-111359175 CTCTGCTGTTTTTACTGGCAAGG + Intronic
1032006612 7:128306912-128306934 CTCTGCAAATAATCCTGGAAAGG + Exonic
1032607082 7:133367296-133367318 CTCTCCAGTTATTCCTTCTCAGG - Intronic
1033259120 7:139827019-139827041 CTCTGCAGAAGTTCCTGGTGGGG - Intronic
1033842198 7:145387806-145387828 CTCTACAGTTATTTCTGCAAAGG + Intergenic
1034835030 7:154344140-154344162 ATCTGCAGTCATTCCTGTTAAGG + Intronic
1036118758 8:5990720-5990742 CTCTCCAGTTCTTCCTTGTTTGG - Intergenic
1043433745 8:80218873-80218895 CTCTACAGATTTTCCTGTTATGG - Intronic
1054966808 9:71037935-71037957 CTGTGCAGTTCTTGCTGCTAAGG + Intronic
1057208348 9:93186110-93186132 CTCTGCAGGTATCCCTGCTGGGG - Intronic
1058147215 9:101425447-101425469 TCCTGCAGCTGTTCCTGGTAAGG - Exonic
1061470341 9:130819912-130819934 TTCTCCAGGCATTCCTGGTATGG + Intronic
1185939894 X:4305087-4305109 TACTGCAGTTCTTACTGGTAAGG - Intergenic
1186583564 X:10847198-10847220 CTCTGCAGTTATCCTAGGAAGGG - Intergenic
1192540987 X:71972981-71973003 CTCTCCAGTCATTCCTGAGAGGG + Intergenic
1195407209 X:104527998-104528020 TTCTGCAGTTATTGATGGAATGG - Intergenic
1197712535 X:129681842-129681864 CTTTCCAGTCATTCCTGGAATGG - Intergenic
1197801519 X:130354546-130354568 GACTGCAGTTAATGCTGGTAAGG + Intronic
1202097208 Y:21264182-21264204 CTGTGCACTCAATCCTGGTAAGG + Intergenic