ID: 983383393

View in Genome Browser
Species Human (GRCh38)
Location 4:167025570-167025592
Sequence GGTCTGTGAGAACCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983383386_983383393 21 Left 983383386 4:167025526-167025548 CCTGTTTGATCATCCAGGGGTTT 0: 1
1: 0
2: 0
3: 11
4: 123
Right 983383393 4:167025570-167025592 GGTCTGTGAGAACCAAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 156
983383388_983383393 8 Left 983383388 4:167025539-167025561 CCAGGGGTTTCTCCTCCAGGTCA 0: 1
1: 1
2: 3
3: 15
4: 217
Right 983383393 4:167025570-167025592 GGTCTGTGAGAACCAAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 156
983383392_983383393 -7 Left 983383392 4:167025554-167025576 CCAGGTCAGGTACTTAGGTCTGT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 983383393 4:167025570-167025592 GGTCTGTGAGAACCAAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 156
983383391_983383393 -4 Left 983383391 4:167025551-167025573 CCTCCAGGTCAGGTACTTAGGTC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 983383393 4:167025570-167025592 GGTCTGTGAGAACCAAAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983383393 Original CRISPR GGTCTGTGAGAACCAAAAGC AGG Intronic
904251859 1:29230821-29230843 GGTCCGTGACAGCCAGAAGCTGG + Exonic
904495342 1:30883434-30883456 AGACTGTCAGAACCTAAAGCTGG - Intronic
905497180 1:38401260-38401282 GGTCAGTGAACACCAAAACCAGG + Intergenic
907002332 1:50874023-50874045 GGTATGTGAGACCCAAAATTTGG + Intronic
907247765 1:53119074-53119096 GGCCTCTGAGACCCAAAAGCAGG - Intronic
911055889 1:93708259-93708281 GTTCTGTGAGACCCTGAAGCAGG - Intronic
913317602 1:117565924-117565946 GGTCTGTGAGAGCAGAAGGCAGG - Intergenic
916665692 1:166965079-166965101 ACTCTTTGAGTACCAAAAGCAGG + Intronic
917055713 1:170978840-170978862 AGTCTGTGGGGACCAAAGGCTGG - Intronic
919022575 1:192126085-192126107 GGTTTGTGAGCATCAAAAACTGG + Intergenic
920296719 1:204962088-204962110 GGTCTGTAACAAACAAAAGAGGG - Intronic
921189379 1:212696268-212696290 GGTCTTTTAGAAGCAAAAGAGGG + Intronic
921436844 1:215133830-215133852 GCTCTGTTAGAACCAAGAGTTGG - Intronic
922280606 1:224119905-224119927 GGTCTGTGAAATAAAAAAGCTGG - Intronic
1063920626 10:10928711-10928733 GGTCTTTGGGAACCAACAGAAGG - Intergenic
1065640769 10:27779989-27780011 GGTCTCTGATCACCAAAAGGAGG - Intergenic
1067479915 10:46587906-46587928 GGGCTGTGAGGACCAGGAGCCGG - Intronic
1067614822 10:47753891-47753913 GGGCTGTGAGGACCAGGAGCCGG + Intergenic
1071808799 10:89155319-89155341 GGTCTCTGGGTACCAAAAGAGGG + Intergenic
1072757883 10:98032371-98032393 GGTCTGTGATCCCCAAAAGGAGG - Intergenic
1074535172 10:114323890-114323912 GTTCTGTGAGAACCACAGGAGGG + Intronic
1075844542 10:125534873-125534895 GGTCTGTAAGATGCAAGAGCAGG - Intergenic
1078531598 11:12140759-12140781 GGTCTGTGACAACAAACAGTAGG - Intronic
1080659834 11:34286682-34286704 GGATGGTGAGAACCAAAAACAGG - Intronic
1083070087 11:59969632-59969654 GTTCTTTTAGAACAAAAAGCTGG - Intergenic
1083669177 11:64291097-64291119 TGGAAGTGAGAACCAAAAGCTGG + Intergenic
1087053002 11:93905163-93905185 GGTCTGGGAAAAGCAAGAGCTGG - Intergenic
1087061785 11:93986067-93986089 GGACTGTGAGGTCCATAAGCAGG - Intergenic
1089080962 11:115775939-115775961 GGGCTGTGAGAGCCAAATGCTGG + Intergenic
1089546706 11:119232456-119232478 GTTGTGTCAGAACCCAAAGCTGG + Exonic
1090828517 11:130404804-130404826 GGCCTGTGAGGACCCAGAGCAGG + Intergenic
1090851716 11:130576493-130576515 GGTCTGTGTGAATTCAAAGCTGG + Intergenic
1092353507 12:7775464-7775486 TGTCTCTGAGAAACAAAAGAAGG - Intergenic
1092510670 12:9152829-9152851 GGTCAGTGAGATCTGAAAGCTGG + Exonic
1093179665 12:15952865-15952887 GGGCTGTCAGAAGCAAAAGCAGG - Intronic
1093494733 12:19743093-19743115 TGTGTTTGAGAACCAAATGCAGG - Intergenic
1096019513 12:48311630-48311652 GGACTGTGAGAACAAAAAGAGGG - Intergenic
1096445583 12:51688228-51688250 GGCCTGTGACATACAAAAGCAGG - Intronic
1097891828 12:64784374-64784396 GGTCTGTAACAAACAAATGCAGG - Intronic
1105623031 13:22087500-22087522 GATGTGTGAGGAGCAAAAGCGGG - Intergenic
1108483510 13:50900763-50900785 GGTCTGTGAGAAAAAAGAGGAGG - Intergenic
1110931497 13:81223987-81224009 GGTCTGCGAGAACCAGCAGCCGG - Intergenic
1116077294 14:40127192-40127214 AGTCTGACAGAACCACAAGCTGG - Intergenic
1116807906 14:49511384-49511406 GGCCTGAGAGAACAAAAAGGTGG - Intergenic
1118829139 14:69413024-69413046 GATCTATGAAACCCAAAAGCTGG - Intronic
1122488290 14:102096043-102096065 GGTCTGAGAGCACCAAGATCAGG - Intronic
1123688924 15:22820889-22820911 GCTCTGTGAGAACAAAGACCTGG + Intronic
1125111642 15:36040888-36040910 TGTATGTGGGAACTAAAAGCGGG - Intergenic
1125137930 15:36366188-36366210 GGGCTGTGAGAAGAAAAAGTGGG + Intergenic
1125442657 15:39719708-39719730 TGTCTGGCAGTACCAAAAGCAGG + Intronic
1125512100 15:40297603-40297625 GGTCTGCGGGGAGCAAAAGCGGG + Exonic
1130012577 15:80163119-80163141 GGTCTGTTAGAACCAAGATGAGG + Intronic
1130641443 15:85679430-85679452 GGGCAGGGAGAACCAAAAGAAGG + Intronic
1131222178 15:90594160-90594182 TGTCTGTAAGTTCCAAAAGCAGG - Intronic
1131915234 15:97257967-97257989 GCTCTGTGAGCACCAAAGACAGG - Intergenic
1140545881 16:75808510-75808532 GGTCTGTGCGATTCCAAAGCTGG - Intergenic
1141176974 16:81727208-81727230 AGGCTGTGAGAAGCAAAGGCAGG - Intergenic
1141473855 16:84258702-84258724 GGTCTGTGTGGACCAAAGGGAGG - Intergenic
1141679770 16:85537285-85537307 TGCCTGTGAGAATCAAAATCAGG - Intergenic
1146543572 17:33718861-33718883 GGTCAGTGACAGCCAGAAGCAGG + Intronic
1146694664 17:34899339-34899361 GATCTGGGAGAGCCAAAAGGTGG - Intergenic
1147129121 17:38395828-38395850 GGTCTGTGAAAAACAAATGACGG - Exonic
1148036626 17:44668117-44668139 GGTCTTTGAAATCCAAAAGTTGG - Exonic
1149700931 17:58654845-58654867 GGACTGTGAGAACAAGAAGCTGG + Intronic
1149701054 17:58655658-58655680 GGACTGTGAGAACAAAAAGCTGG + Intronic
1153675100 18:7450264-7450286 GGTTTGTGAGCACCAAAGACTGG + Intergenic
1155220580 18:23681957-23681979 GGACTGTGTGAAACAAGAGCTGG + Intergenic
1156562312 18:38139306-38139328 GATCAGTGAGAAAGAAAAGCTGG + Intergenic
1159793367 18:72811861-72811883 GGTCTCCAAGAACCAAAAGAAGG - Intronic
1160028712 18:75240450-75240472 GGCCTGTGAGTACCCAAAGAGGG + Intronic
1160716625 19:579725-579747 GGTCCGTGAGAACAAAAGACCGG + Intronic
1160721513 19:599125-599147 GGTCTGCAAGAGCCAAACGCTGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162816509 19:13198651-13198673 GGTATGAGAGAACCAAGAGTGGG + Intergenic
1163521966 19:17796733-17796755 GGTGTGGGAGAACCAAAAGGGGG + Intronic
1166198427 19:41221065-41221087 GGTCTGTCAGAACGGAAAGAGGG - Intronic
1166772669 19:45293817-45293839 GGCCTGTGGGAACCCAAAGGAGG + Intronic
1167015735 19:46839789-46839811 GGGCTGTGAGAGCCCAAAGAGGG + Intronic
1167120455 19:47513706-47513728 GGACTGAGAGAACCAAAACGGGG - Intronic
926789974 2:16560692-16560714 GATCTGTAAGAACCAAATGGAGG - Intronic
926818895 2:16830926-16830948 TGTCTGTGAGAACAAAAGCCTGG - Intergenic
927132395 2:20071611-20071633 GGGCTGTGAGAGCCAGAAGGGGG + Intergenic
927812898 2:26189994-26190016 GGTCTGAGAGAGCCTGAAGCCGG - Intergenic
928449491 2:31365849-31365871 GGGCTGTGAGAATTCAAAGCAGG + Intronic
930072000 2:47373467-47373489 TGTCTGTGAAAACTACAAGCTGG + Exonic
930263687 2:49175858-49175880 GGTCTGAGAGACCCAAGAGTTGG + Intergenic
931671271 2:64650139-64650161 GGTCTGAGGGATCCCAAAGCTGG - Intronic
935379876 2:102440696-102440718 GGTCTCTGAGAAGTAAAAGTAGG + Intronic
937056535 2:118941977-118941999 GGTCCCTGAGACCCAAAAGCTGG - Intergenic
939416073 2:141898833-141898855 GGTTTGTGATAACCACAACCAGG + Intronic
942226330 2:173819725-173819747 TGTAGGTGAGAACAAAAAGCTGG - Intergenic
942774754 2:179567931-179567953 GCTGTGTGAGAACCAAATGTCGG - Intronic
947928905 2:233946276-233946298 GGTTTGTTAGTATCAAAAGCTGG + Intronic
948210188 2:236187261-236187283 TGGCTGTGAGCACCACAAGCAGG + Intergenic
1170332065 20:15224075-15224097 GGACTGTGGGAGCCAAAGGCTGG - Intronic
1170477449 20:16730026-16730048 CTACTGTAAGAACCAAAAGCAGG - Exonic
1172763331 20:37336939-37336961 AGACTGTGAGAACTGAAAGCTGG + Intergenic
1176092394 20:63325067-63325089 GGTCTGGGAGAACCCACAGCAGG - Intronic
1177961001 21:27665908-27665930 GGTTTGTGAGAAGAGAAAGCTGG + Intergenic
1179802243 21:43816542-43816564 GGTCTGGGAGAACCCACAGCAGG - Intergenic
1180874304 22:19167937-19167959 GGGCTGTCAGCACCAAAACCTGG - Intergenic
1184077787 22:42194283-42194305 GGTCTGAGAGAACAGAATGCTGG + Intronic
1184460489 22:44635074-44635096 GGTGTATGAGAAACAAAATCTGG + Intergenic
1185254290 22:49823705-49823727 GCACTGCGAGAACCAGAAGCAGG - Exonic
950401751 3:12774340-12774362 GGTCTAACAGAACCAAAAGGTGG - Intergenic
950939964 3:16883521-16883543 GGTGCGTGAGAACCAGAAGAGGG + Intronic
951030979 3:17881533-17881555 GATCAGTGAGAAACAAAAGGTGG - Intronic
951754197 3:26071720-26071742 GATCTGGGAGAACCAGAAGTGGG - Intergenic
953069319 3:39503509-39503531 GGACCATGAGAACCATAAGCAGG + Intronic
954334069 3:49905980-49906002 GGTCTGTGAGACCCAGGAGAGGG - Intronic
954370711 3:50168406-50168428 GGTCTGTGGGAGCCCAAGGCAGG + Intronic
954441550 3:50525005-50525027 GGCCTGTGACAGCCAGAAGCAGG - Intergenic
955459713 3:59168393-59168415 GGACTGTGAGAACCAGGAGGAGG + Intergenic
960053676 3:113261075-113261097 GGTGTGTGGGAAGAAAAAGCAGG + Intronic
960532093 3:118776473-118776495 GTGCTGTGATAAACAAAAGCAGG - Intergenic
962690397 3:137891031-137891053 GTACTGGGAAAACCAAAAGCTGG - Intergenic
964317721 3:155461924-155461946 GGGCTCTGGGAACCAAAAGGTGG + Intronic
972793387 4:42393953-42393975 GATTTGAGAAAACCAAAAGCAGG - Intergenic
977755982 4:100672746-100672768 GGTCCGTGTGATCCACAAGCAGG + Intronic
979962182 4:127034312-127034334 GGTCTCTGCAAACAAAAAGCAGG + Intergenic
983383393 4:167025570-167025592 GGTCTGTGAGAACCAAAAGCAGG + Intronic
984180819 4:176480348-176480370 GGATTAAGAGAACCAAAAGCTGG + Intergenic
986000029 5:3623118-3623140 GGTGTGTGAGAAACAATACCTGG - Intergenic
988428643 5:31093239-31093261 GGTGTTTGAGATCCAAAAGCTGG + Intergenic
988641717 5:33048215-33048237 GGACTGTGATAACCAGAGGCTGG + Intergenic
989458420 5:41668562-41668584 GGTCTCTGAGAACCCAAGTCAGG + Intergenic
990868920 5:60409871-60409893 GGAGTGTGAGAAGGAAAAGCAGG + Intronic
991579588 5:68140476-68140498 GGGCTGTGAGAACCTGAATCTGG - Intergenic
991975337 5:72179256-72179278 GGTCTGAGGGCAGCAAAAGCGGG - Intronic
992098899 5:73387271-73387293 GCACTGTGAGAACCAGAAGGGGG - Intergenic
992124615 5:73627061-73627083 GGTCTCTGGGAAACCAAAGCTGG - Intronic
995379260 5:111513421-111513443 GTAGTTTGAGAACCAAAAGCAGG + Intergenic
997600221 5:135133976-135133998 GGACTCTGAGAACCAAGATCGGG - Intronic
998457168 5:142282291-142282313 GGTTTGTGAGAATCAAAAGTTGG + Intergenic
998955388 5:147433191-147433213 GGCCTGTGAGAAGCAAGAGTAGG + Intronic
999355663 5:150928448-150928470 GGTCAGTTAGAAACAAAAGGTGG - Intergenic
1001929920 5:175665519-175665541 GGGCTGTTAGAACCCAGAGCAGG + Intronic
1002568606 5:180127827-180127849 GCTCTGTGACAACCTAAAACAGG - Intronic
1003950080 6:11108693-11108715 GGTCTTTTACAACCAAAACCAGG - Intronic
1006378762 6:33685797-33685819 GCTGTGTGAGAACCACAACCGGG + Exonic
1010217542 6:73418034-73418056 GTTCAGTGAAAACCAACAGCAGG + Intronic
1015339792 6:132085175-132085197 GGCCTGTGAGAACCCAATGCAGG + Intergenic
1017630186 6:156389449-156389471 GGCCATTGAGAACCCAAAGCTGG + Intergenic
1022971686 7:35523568-35523590 GCTCTGTGATCACCCAAAGCAGG - Intergenic
1023162074 7:37307303-37307325 GGTCTGTGAGAACAGAATGGAGG - Intronic
1026300198 7:69091011-69091033 GCTCTGAGAGAACCAGAATCAGG - Intergenic
1028604466 7:92640548-92640570 ATTCTGTCAGGACCAAAAGCTGG - Intronic
1032542096 7:132711687-132711709 GGTGAGTGAGACCCCAAAGCTGG - Intronic
1033009368 7:137603976-137603998 AGTCTGGGAGAAAAAAAAGCTGG - Intronic
1033943660 7:146686674-146686696 GGTATATGAGAACAAAATGCTGG + Intronic
1037211298 8:16391622-16391644 TTTTTGTGAAAACCAAAAGCTGG - Intronic
1039580268 8:38660238-38660260 GGTTTGTGAAAACCACAAGCTGG + Intergenic
1044815510 8:96108448-96108470 GTTCTGTGAGGACAAGAAGCGGG - Intergenic
1055417356 9:76097957-76097979 GATCTGTTAGAGCCAGAAGCAGG - Intronic
1056135922 9:83629350-83629372 GATCTTTGAGAACTCAAAGCTGG + Intronic
1056294863 9:85182462-85182484 AGTCTGTAAGAAACAAAGGCAGG + Intergenic
1057583615 9:96309643-96309665 GTTCTGTGAGATCCAAAAGTAGG - Intergenic
1057713583 9:97469226-97469248 GGCCTATGAGAAGCAAAAGCAGG + Intronic
1057948005 9:99346562-99346584 GGTCTGTGACAGCTTAAAGCAGG + Intergenic
1058381841 9:104385200-104385222 GTTCTGTGAGTCCCAATAGCTGG + Intergenic
1058439274 9:104992121-104992143 GGGTTGTGAGAATCAAAAGAAGG - Intergenic
1058648297 9:107151256-107151278 AGGCTGTGAGAACCTACAGCAGG - Intergenic
1060246734 9:121952756-121952778 GGTTTGTGGGAACCAGAACCAGG - Intronic
1060945659 9:127568425-127568447 GGTCTGGGAGATCCCAAAGCTGG + Intronic
1185499430 X:585502-585524 GGCCTGGGAGAACTCAAAGCCGG - Intergenic
1186091470 X:6053182-6053204 GGTCTGTGAAAACGGAAATCTGG + Intronic
1188860061 X:35244911-35244933 TGTCTGTGGGCACCAAAAGTGGG + Intergenic
1190028657 X:46950561-46950583 TGTTCATGAGAACCAAAAGCTGG - Intronic
1191192243 X:57679325-57679347 GGACTGGGAGAAGCAGAAGCCGG - Intergenic
1195538504 X:106035886-106035908 GGTCTGTGTGAGTCTAAAGCTGG - Intronic
1195763715 X:108274433-108274455 GGTATGTAAGAACCAGACGCAGG + Intronic
1198033029 X:132773798-132773820 GATTTGTGACCACCAAAAGCTGG + Intronic
1198717875 X:139580940-139580962 GGTAGGAGAGAACCCAAAGCAGG - Intergenic
1201059885 Y:10036263-10036285 GGTCTGTGGGAGCCTAAAGGAGG + Intergenic
1201068310 Y:10120669-10120691 AGTCTGTGAAAAACAAATGCTGG + Intergenic