ID: 983387594

View in Genome Browser
Species Human (GRCh38)
Location 4:167084986-167085008
Sequence CTTTTGTCCAGAGGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983387594 Original CRISPR CTTTTGTCCAGAGGGATCCA GGG Intronic
903562641 1:24239708-24239730 CTTCAGTCCAGGGGAATCCAAGG - Intergenic
903763355 1:25715251-25715273 CTCATGTCCAGAGGGATGAAAGG + Intronic
906332019 1:44893752-44893774 TTCTTGTCCAGAAGTATCCACGG - Intronic
907547796 1:55277323-55277345 CTTTTGTTGAGAGGCAACCATGG + Intergenic
907636393 1:56139173-56139195 ATTTTGTCCCGAGGGTTTCATGG + Intergenic
911080075 1:93920053-93920075 CTTTTCTCAATAGGGAGCCATGG + Intergenic
912782296 1:112562407-112562429 CTTTTGTTCAGAGGGAACTATGG + Intronic
914863237 1:151403964-151403986 CCTTTGTCCAGAGGGATGGATGG + Exonic
915336593 1:155146626-155146648 CTCTTGTCCAGTGCTATCCAAGG - Intergenic
915878582 1:159641487-159641509 GTTATGTCCAGAAGGAACCAGGG - Intergenic
916517700 1:165535283-165535305 ATTCTGTCTAGAGGAATCCAAGG + Intergenic
920145153 1:203854165-203854187 CTCTTGTCAAGATGGATCCCAGG - Intergenic
920203436 1:204274929-204274951 CTGTCCTCCAGGGGGATCCATGG + Intronic
920575392 1:207055827-207055849 CTTCTGTCCAGCAGGCTCCATGG - Intronic
1062771504 10:104959-104981 CCAAAGTCCAGAGGGATCCAAGG + Intergenic
1063137762 10:3231856-3231878 ATTTTGTGTAGAGGGATTCAGGG + Intergenic
1069586492 10:69607449-69607471 CTTCTGTCAAAAGGGCTCCAGGG - Intergenic
1069732396 10:70625854-70625876 CTTTTGGCCAAGGGGATCCTAGG + Intergenic
1071242474 10:83723236-83723258 CGTTTCTCCAGATGGCTCCATGG - Intergenic
1073128905 10:101172323-101172345 TTTTTGTCCATATGTATCCAGGG + Intergenic
1074362593 10:112835128-112835150 CTTTTGTCCTGGGAGATCCAGGG - Intergenic
1076192123 10:128490324-128490346 CTGTTCTCCAGATGGATCCATGG - Intergenic
1077330407 11:1981671-1981693 CCCTTGTCCAGAGGGACCCGTGG - Intronic
1081141243 11:39503152-39503174 ATTTTGTCCAGATTGGTCCATGG + Intergenic
1081298382 11:41420218-41420240 CATTTCTCCAAAGAGATCCAGGG + Intronic
1083168788 11:60909590-60909612 CTGTTGACCAGAAAGATCCAGGG + Intergenic
1083404514 11:62447330-62447352 CTTCTGCCCAGTGGGATCTAGGG + Intronic
1084878219 11:72149817-72149839 CTTTTTTGGGGAGGGATCCAGGG + Intergenic
1085588897 11:77738543-77738565 CTTTTGTCCCTTGGTATCCATGG - Intronic
1086025906 11:82291207-82291229 CTGTTCTCCAGATGCATCCATGG + Intergenic
1089137386 11:116260578-116260600 CTTTAATCCAGAAAGATCCAGGG + Intergenic
1089509192 11:118985145-118985167 CCCTTGTCCAGAGGGCTCCCAGG + Intergenic
1089847210 11:121467682-121467704 CTGATCTCCAGATGGATCCAGGG + Intronic
1202813386 11_KI270721v1_random:36850-36872 CCCTTGTCCAGAGGGACCCGTGG - Intergenic
1093088822 12:14897540-14897562 ATTTTGTCCAGAGGGACACTAGG + Intronic
1093146114 12:15568817-15568839 CTTTTGTCCAGAAAGCTCCCAGG - Intronic
1095910600 12:47422814-47422836 ATTTTGCCCAGATGCATCCAAGG - Intergenic
1106368124 13:29104024-29104046 CTCATGTCCAGGGGGATGCATGG - Intronic
1109075103 13:57824129-57824151 CTTTTGCCCAGAGAGTTCCAAGG - Intergenic
1113641361 13:111959608-111959630 CTTGTGTTCAGAGGATTCCAGGG + Intergenic
1116196030 14:41726246-41726268 TTGTTGTTCAGAGGGATCCAGGG + Intronic
1116978563 14:51142874-51142896 CTCTTGACCAAAGGGACCCAAGG - Intergenic
1122936108 14:104957051-104957073 CTTGTCTCCAGAGGTAGCCATGG + Intronic
1126724524 15:51618135-51618157 CTTTTGGCCAGGGGAATCAAGGG - Intronic
1127728006 15:61769848-61769870 CTGATGTGCAGAGGGATTCAGGG - Intergenic
1129381571 15:75171006-75171028 GACTTGTCCAGAGGGATGCAGGG + Intergenic
1129631662 15:77267023-77267045 CTTTTGGGCAGTGGGATGCATGG + Intronic
1131092315 15:89632133-89632155 CTGATGTCCAGGAGGATCCAGGG - Intronic
1135245928 16:20857105-20857127 TTTTTCTGCAAAGGGATCCAAGG - Exonic
1137597491 16:49734499-49734521 CTTTTCTGCAGAGGCCTCCAGGG + Intronic
1138203258 16:55105658-55105680 CATGTGCCCAGAGGGAGCCAGGG + Intergenic
1138381129 16:56603331-56603353 CTTTATTCAAGAGGCATCCAAGG - Intergenic
1138407495 16:56809174-56809196 CTTTGTGCCAGAGGGAGCCAGGG + Intronic
1141903061 16:87005484-87005506 CCTTTGACCAGCAGGATCCAAGG + Intergenic
1146974320 17:37098024-37098046 CTTTTGTGCAGAGAGATTCCTGG - Intronic
1147175860 17:38655788-38655810 CTTGTGTCCAGAGGGCTCAGTGG - Intergenic
1147327086 17:39674807-39674829 GGTTTGTTCAGAGGGCTCCAGGG - Intronic
1149552700 17:57551970-57551992 CTTTGGAGCTGAGGGATCCAGGG - Intronic
1155414535 18:25582488-25582510 ATTTTGACCAGAGGGATAAAAGG - Intergenic
1157480544 18:48050908-48050930 CTTATGTACACAGGGATCCTAGG - Intronic
1158802550 18:60929800-60929822 CTTTTGTCCATAGAGATACTGGG - Intergenic
1158978246 18:62732671-62732693 ATTTTGTCCAGATGTATCAAGGG - Intronic
1162565225 19:11442218-11442240 CTTCTCTCCAGAGGGCTACAGGG + Intronic
1166855266 19:45780098-45780120 CATTGGCCCAGAGGGCTCCAAGG + Exonic
926292400 2:11541349-11541371 CTCTCCTCCAGAAGGATCCATGG - Intronic
926532167 2:14062118-14062140 CCTTTGTCCACCTGGATCCACGG - Intergenic
929121864 2:38490140-38490162 CTTCTGTCCTGTGGGCTCCAAGG - Intergenic
929962511 2:46507163-46507185 TTCTTGTCCAGAAGGATCCTTGG + Intronic
930022400 2:47009300-47009322 CTTGTTTCCAGAGAGAGCCATGG + Intronic
931426916 2:62179724-62179746 CTTTTGTCCAGCAGGCACCATGG + Intergenic
932732251 2:74229623-74229645 CTTTTGTAGAGAGGGTTCTAAGG - Intronic
939836707 2:147137924-147137946 CTTATGACCAAAGGAATCCAGGG + Intergenic
941072043 2:160966464-160966486 CTTTTTTACAGAGGGTTGCAAGG - Intergenic
941186505 2:162326346-162326368 CTTTTGTGCAGAGGGCTACAAGG + Intronic
943037845 2:182768409-182768431 CATGTGTCCAGAGGAGTCCAGGG + Intronic
943950541 2:194128945-194128967 CCATAGTCCAGAGGGGTCCAAGG + Intergenic
944365031 2:198908457-198908479 CTTTTGTCCAAAGGGGTCTGTGG + Intergenic
946093136 2:217248468-217248490 CTTTTTCCCAGAAGGCTCCAGGG + Intergenic
1169713472 20:8590214-8590236 TTTTTGTCCAGAGAGTGCCAAGG + Intronic
1173413995 20:42839614-42839636 CTTTTGGCCAGCAGGATTCAAGG - Intronic
1173547299 20:43908698-43908720 CTGTTGGCCAGAGGGCACCATGG + Intergenic
1174855621 20:54042575-54042597 CTTATATCCAGAGGTATCCCAGG - Intronic
1177491301 21:21829468-21829490 CTTTTTTCCAAAAGGATCCCAGG - Intergenic
1177619974 21:23576369-23576391 CTTTTGTTCAGAGTGCTACAAGG - Intergenic
1179044482 21:37832318-37832340 CTTTTGTCCCGGGGGATAAAGGG + Intronic
1179345435 21:40551899-40551921 CTCTTGGCCAAAGGGACCCAAGG - Intronic
1182540729 22:31039872-31039894 CCTTTGTCCATAGGGATCCTGGG + Intergenic
1184344665 22:43905780-43905802 CTGTTTTCCAGAGGGATTCATGG - Intergenic
953899540 3:46832089-46832111 CCTTTTTCCAGAGGGATGCTGGG - Intronic
953981409 3:47414984-47415006 CTTTTGTCCTCAGGGACCCCAGG - Exonic
955483040 3:59408603-59408625 CTATTTTTCAGAGGGATCCCTGG + Intergenic
963727661 3:148940078-148940100 CTTTTGTCCTTAGGCATCTATGG + Intergenic
970091597 4:12414491-12414513 CTTGTGTGCAGAGGAATGCAGGG + Intergenic
971031094 4:22637565-22637587 CTTTTGTCCACAGGATGCCATGG - Intergenic
971181083 4:24329125-24329147 CTTTTGTCCAGACTGACCCAGGG + Intergenic
971424540 4:26503051-26503073 CTTTTCCGCAGTGGGATCCAGGG - Intergenic
975802902 4:78081038-78081060 CTCTTTTCCAGGGGGATCCTAGG - Intronic
980079338 4:128327406-128327428 CTTAGGTCCAGCTGGATCCAAGG - Intergenic
983387594 4:167084986-167085008 CTTTTGTCCAGAGGGATCCAGGG + Intronic
984537398 4:180993939-180993961 GTTTTGTTCAGTGGGATCAAGGG - Intergenic
986738221 5:10683006-10683028 CTATTTTCCAGAGGGATCAATGG + Intronic
987104196 5:14621181-14621203 ATTTTGTCAAGAGCGAGCCAGGG + Intergenic
992872436 5:81020646-81020668 CTTTTTGCCAGAAGGCTCCAGGG + Intronic
993483489 5:88453050-88453072 TGTTTGTACAGAGAGATCCAGGG + Intergenic
995248256 5:109960204-109960226 CTTTTGTCCTGAGGGTTCTGGGG + Intergenic
995594227 5:113731077-113731099 CTTTTCTCCTGATGGAGCCAGGG - Intergenic
998501844 5:142640105-142640127 TTTTTGTGAAGAGGGGTCCAGGG - Intronic
999182810 5:149681839-149681861 CTTTTGTCTCTAGGAATCCAGGG + Intergenic
999368503 5:151038552-151038574 CCCTTGTGCAGTGGGATCCAGGG - Intronic
1000192423 5:158924393-158924415 TCTTTGTCCAGTGGCATCCAGGG - Intronic
1002040820 5:176512932-176512954 CTTTTATCCTGAGGGAGCCTCGG + Intergenic
1002064727 5:176646397-176646419 CATTTGTACAGAGGGATACGTGG + Exonic
1002604731 5:180375829-180375851 CTGTTGTCCAGAGAGACTCAGGG + Intergenic
1005995881 6:30931249-30931271 CTGTTGAGCAGAGGGTTCCAGGG - Intergenic
1007425690 6:41744536-41744558 GTTAGTTCCAGAGGGATCCAGGG + Intronic
1008703245 6:54127044-54127066 CATTTGACCAGAGGAATCAAGGG - Intronic
1010823729 6:80447616-80447638 CTTTTGTCCCAAGGAATCCATGG + Intergenic
1018506569 6:164476499-164476521 CTCTTTTCCAAAGGGATTCAAGG + Intergenic
1019144884 6:169970218-169970240 CTTTTCTGCTGAGCGATCCAGGG - Intergenic
1025035768 7:55591715-55591737 CTTCTCTCCAGGGGGACCCAGGG - Intergenic
1025304684 7:57845129-57845151 TATTTTTCCAGAGTGATCCAGGG + Intergenic
1027160788 7:75800680-75800702 TTTTTATCCAGAGGCATCCGTGG + Intergenic
1028122731 7:87074336-87074358 CATTTGTCCACAAGGATACAAGG + Intergenic
1029829678 7:103243646-103243668 CTTTTGTTCAGAGTGTTCAAAGG - Intergenic
1035269054 7:157709262-157709284 CTTTTGTCCAGAGCTGTGCATGG - Intronic
1037205777 8:16318746-16318768 CTTTTGTCCAGAATTATACAGGG + Intronic
1037659128 8:20912093-20912115 CTTTTGTCCTAATGGAACCAAGG - Intergenic
1037793194 8:21966285-21966307 CTTTAGACATGAGGGATCCAGGG + Intronic
1038752855 8:30313090-30313112 CTTCTGTCCCGAGGTCTCCAAGG + Intergenic
1040126234 8:43740700-43740722 CTTTTTCCCATAGGGCTCCAAGG - Intergenic
1040789746 8:51212603-51212625 CTTTTTTCCACAGGTTTCCATGG - Intergenic
1042989965 8:74628242-74628264 CTTTTGTCCAAAGAGTTCCTGGG - Intronic
1043468965 8:80543276-80543298 CTTTAACCCAAAGGGATCCAGGG - Intergenic
1046542522 8:115604652-115604674 ATTTTGTCTAGAGGAATCGAGGG + Exonic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1048857398 8:138696403-138696425 CTTTCTTCCAGATGCATCCATGG - Intronic
1055908848 9:81324896-81324918 CTTTTGACCAAAGGGACCAAAGG - Intergenic
1056937126 9:90924529-90924551 CTTTTGACGAGGAGGATCCAGGG - Intergenic
1057518773 9:95743887-95743909 CTTTTGCCCAGAGGGTGCTAGGG - Intergenic
1058404442 9:104656157-104656179 CTTTTGTGCAGAGGTGTCTAAGG - Intergenic
1058503473 9:105646371-105646393 GTCTTATCCAGAGGGTTCCAGGG + Intergenic
1061679095 9:132233985-132234007 CTATTGTCCTGAGGCCTCCAGGG + Intronic
1186433856 X:9527085-9527107 CCTTTGTCCTGTGTGATCCACGG - Intronic
1188262020 X:28033824-28033846 CTTGTGTCCAGAGGAATCCCAGG + Intergenic
1188542986 X:31270152-31270174 CTTTTGCCCAAAGGGATAAAGGG - Intronic
1192237695 X:69306355-69306377 CTTTTGTCCAAAGGGACATAGGG - Intergenic
1197685053 X:129430165-129430187 GTTCTTTCCAGAGGGTTCCATGG - Intergenic
1202082003 Y:21093106-21093128 CTTTTGTCCTGCTGGAGCCAGGG + Intergenic