ID: 983388840

View in Genome Browser
Species Human (GRCh38)
Location 4:167102799-167102821
Sequence CCTAGCAATTACAGTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 10, 3: 99, 4: 448}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983388840_983388845 2 Left 983388840 4:167102799-167102821 CCATAAGGACTGTAATTGCTAGG 0: 1
1: 0
2: 10
3: 99
4: 448
Right 983388845 4:167102824-167102846 AGTCCTAGGCTCAGAGACAGGGG No data
983388840_983388849 21 Left 983388840 4:167102799-167102821 CCATAAGGACTGTAATTGCTAGG 0: 1
1: 0
2: 10
3: 99
4: 448
Right 983388849 4:167102843-167102865 GGGGATGTGGGACACCAGCCAGG 0: 1
1: 0
2: 4
3: 28
4: 312
983388840_983388844 1 Left 983388840 4:167102799-167102821 CCATAAGGACTGTAATTGCTAGG 0: 1
1: 0
2: 10
3: 99
4: 448
Right 983388844 4:167102823-167102845 AAGTCCTAGGCTCAGAGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 196
983388840_983388843 0 Left 983388840 4:167102799-167102821 CCATAAGGACTGTAATTGCTAGG 0: 1
1: 0
2: 10
3: 99
4: 448
Right 983388843 4:167102822-167102844 CAAGTCCTAGGCTCAGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 207
983388840_983388850 25 Left 983388840 4:167102799-167102821 CCATAAGGACTGTAATTGCTAGG 0: 1
1: 0
2: 10
3: 99
4: 448
Right 983388850 4:167102847-167102869 ATGTGGGACACCAGCCAGGACGG 0: 1
1: 1
2: 1
3: 36
4: 235
983388840_983388848 9 Left 983388840 4:167102799-167102821 CCATAAGGACTGTAATTGCTAGG 0: 1
1: 0
2: 10
3: 99
4: 448
Right 983388848 4:167102831-167102853 GGCTCAGAGACAGGGGATGTGGG No data
983388840_983388847 8 Left 983388840 4:167102799-167102821 CCATAAGGACTGTAATTGCTAGG 0: 1
1: 0
2: 10
3: 99
4: 448
Right 983388847 4:167102830-167102852 AGGCTCAGAGACAGGGGATGTGG 0: 1
1: 0
2: 6
3: 73
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983388840 Original CRISPR CCTAGCAATTACAGTCCTTA TGG (reversed) Intronic
902160014 1:14522447-14522469 CCTAACAATTACAGTTATCAAGG + Intergenic
904793186 1:33039093-33039115 CCTAGAGATTACAGGGCTTATGG + Intronic
906353078 1:45080201-45080223 CCTAGGAGTTGCAGTCCTTGCGG + Intronic
906915413 1:50004363-50004385 CCCAGGAATTACAGTCCTAGTGG - Intronic
907023666 1:51094450-51094472 CCAAGAAATTGCAGTCCTTGTGG - Intergenic
908397668 1:63741004-63741026 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
909128468 1:71706407-71706429 CCTAAGAGTTGCAGTCCTTATGG - Intronic
909270549 1:73618011-73618033 CCTACAAATTGCAGTCCTTATGG + Intergenic
910055240 1:83025606-83025628 CCTAGCATGTTCAGTACTTAAGG - Intergenic
910515479 1:88055005-88055027 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
910547246 1:88432526-88432548 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
910560182 1:88581855-88581877 CCTAGGAACTGCAGTCCTTGTGG - Intergenic
911012567 1:93296826-93296848 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
911019756 1:93374852-93374874 CCTAGGAACTGCAGTCCTTGTGG - Intergenic
911536330 1:99105373-99105395 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
912035064 1:105301919-105301941 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
912036735 1:105325494-105325516 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
912102779 1:106232656-106232678 CCTAGGAGTTACAGTCCTTGTGG + Intergenic
912135788 1:106659019-106659041 CCTAAGAGTTTCAGTCCTTATGG - Intergenic
912170128 1:107089867-107089889 CCTGGCTATTACAATTCTTATGG + Intergenic
912280619 1:108308853-108308875 CCTAGCAATTGAAGTCCTTATGG + Intergenic
912287607 1:108385504-108385526 CCTAGCAATTGAAGTCCTTATGG - Intronic
912633339 1:111268090-111268112 CCTAGAAGTTGCAGTCCTTGTGG + Intergenic
912871441 1:113310717-113310739 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
912899332 1:113630895-113630917 TCTAGGAATTGCAGTCCTTGTGG + Intronic
913514798 1:119595647-119595669 CCTAGCATCTAGAGTCCTTGGGG - Intergenic
917373174 1:174317715-174317737 CCTAAGAGTTGCAGTCCTTATGG + Intronic
917376514 1:174353472-174353494 CCCAGGGATTACAGTCCTTGTGG + Intronic
917387359 1:174491653-174491675 CCTACGACTTAGAGTCCTTATGG + Intronic
918357924 1:183723735-183723757 CCTAGGAGTTGCAGTCCTTATGG - Intronic
918476291 1:184928420-184928442 CCTAGGAATTACAGTCTTTGTGG + Intronic
918666307 1:187155065-187155087 CCTAAGAGTTTCAGTCCTTATGG + Intergenic
918915743 1:190634538-190634560 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
918915853 1:190635321-190635343 TCTAGGAATTGCAGTCCTTGTGG + Intergenic
918994916 1:191745197-191745219 CCAAGCAATTTTTGTCCTTAAGG - Intergenic
919003057 1:191859912-191859934 CCTACAAGTTGCAGTCCTTATGG - Intergenic
919336531 1:196243766-196243788 CCCAAGAATTTCAGTCCTTATGG - Intronic
919514997 1:198511488-198511510 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
920549494 1:206846613-206846635 CCTAGGAGTTGCAGTCCTTCTGG - Intergenic
920596793 1:207279962-207279984 CCCAGGAATTGCAGTCCTTTTGG + Intergenic
920744803 1:208616698-208616720 TCTAAGAATTGCAGTCCTTATGG - Intergenic
921002177 1:211055486-211055508 CCCAGGAATTATAGTCCTTGTGG - Intronic
921042506 1:211447690-211447712 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
921238834 1:213155325-213155347 CCTACAAGTTGCAGTCCTTATGG + Intronic
921296245 1:213706159-213706181 CCTAGGAATTGCAGTCCTTATGG + Intergenic
922388635 1:225114562-225114584 CCTAGGACTTGCAGTCTTTATGG + Intronic
922664731 1:227458906-227458928 TCTAGCATTAACTGTCCTTAAGG - Intergenic
923728330 1:236526625-236526647 TCCAGCAATTACAGTCATTCAGG - Intronic
924629171 1:245721091-245721113 CCTAAGAGTTACAGTCCTTGTGG - Intergenic
1064521755 10:16210060-16210082 CCTAGAAATTGCAGTCCATGTGG + Intergenic
1065431529 10:25661841-25661863 CCTAGGATTTGCAGTCCTTGTGG + Intergenic
1066154678 10:32661942-32661964 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
1066649802 10:37643435-37643457 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
1067032694 10:42888980-42889002 CCTGGGAATTGCAGTCCTTGTGG + Intergenic
1067798908 10:49343216-49343238 CCTAAGAATTGCAGTCCTTATGG - Intergenic
1071799515 10:89043119-89043141 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1072130954 10:92493618-92493640 CTCATCAAGTACAGTCCTTAGGG + Intronic
1072842960 10:98795599-98795621 CCTAGGAATTGCAGTCCCTGTGG - Intronic
1072862617 10:99022420-99022442 CCTAAGAGTTGCAGTCCTTATGG - Intronic
1073708274 10:106011265-106011287 CCTAGGAGTTGCAGTCCTTTTGG + Intergenic
1075194899 10:120347993-120348015 CCTAGGAATTGCTGTCCTTGTGG - Intergenic
1078073255 11:8133361-8133383 CCTAGCCCTTACAGTCTTTAGGG + Intronic
1078244682 11:9563405-9563427 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
1078780679 11:14436212-14436234 CCTGCCAATTTCACTCCTTAGGG + Intergenic
1079258244 11:18851995-18852017 CCTAGAAGTTGCAGTCCTTATGG - Intergenic
1079272367 11:19000284-19000306 CCTATGCATTACAGTTCTTATGG + Intergenic
1079701773 11:23556754-23556776 TCTAGAAGTTACAGTCCTTGTGG + Intergenic
1079706896 11:23632615-23632637 CCTAAGAGTTTCAGTCCTTATGG - Intergenic
1080128494 11:28766136-28766158 CCTAGGAATTGTAGTCCTTCTGG - Intergenic
1080213757 11:29817660-29817682 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1080796378 11:35567546-35567568 CCAAGGAACTGCAGTCCTTATGG - Intergenic
1081031183 11:38085494-38085516 CCTAGCAATCAAAATCCATAAGG - Intergenic
1081681212 11:45005313-45005335 CCCAGCAATTTCACTCCTAAGGG - Intergenic
1082225588 11:49702994-49703016 CCCAGGAATTACAGTCCTTGTGG + Intergenic
1082721220 11:56679442-56679464 CCCAGAAATTACAGTCTTTGTGG - Intergenic
1082970141 11:59012019-59012041 CCTAAGAGTTGCAGTCCTTATGG - Intronic
1083512863 11:63227721-63227743 CCTAGAAGTTGCAGTCCTTGTGG + Intronic
1084665005 11:70571623-70571645 CCTAGCAAATTCTGTCCTTGGGG + Intronic
1084763931 11:71295171-71295193 CCCAGGGATTACAGTCCTTGTGG + Intergenic
1085194826 11:74662751-74662773 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
1085572209 11:77569302-77569324 CCCAGCAATTGCAATCCTTAGGG + Intronic
1086006608 11:82046072-82046094 CCTAAGAATTGCAGTCCTTATGG - Intergenic
1086623487 11:88916588-88916610 CCCAGGAATTACAGTCCTTGTGG - Intronic
1086838299 11:91653320-91653342 CCTAGGACTTGCAGTCCTTGTGG + Intergenic
1087299216 11:96413181-96413203 CCTAGCAGTTGCAGTCCTTGTGG - Intronic
1087313470 11:96577726-96577748 CCTAGGAATTGCAGTCCTTATGG + Intergenic
1087349961 11:97019375-97019397 CCTAGGAATTGCATTCCTTGTGG - Intergenic
1087598450 11:100283505-100283527 CCTAGGAGTTACAGTCCTTGTGG + Intronic
1088274019 11:108065369-108065391 CCTAGAAGTTACAGTCCTTGTGG + Intronic
1090676999 11:129007792-129007814 CCTAGGAGTTGCAGTCCTTGCGG + Intronic
1092788556 12:12051846-12051868 TGTAGCTATTACAGTACTTACGG - Intronic
1093403484 12:18776849-18776871 CCTAGGAATTGCAGTCTTTGTGG - Intergenic
1093538123 12:20247500-20247522 CCTAGAAGTTGCAGTCCTTGTGG - Intergenic
1093931658 12:24960558-24960580 CCCAGGAATTACAGTCCTTGTGG - Intergenic
1093991009 12:25590473-25590495 CCTAGGAGTTGCAGTCCTTGTGG - Intronic
1094258478 12:28464264-28464286 CCTAGATATTGCAGTCCTTGTGG - Intronic
1094655962 12:32419640-32419662 CCTAGGAATTGCAGTCCTTGTGG + Intronic
1095163240 12:38941265-38941287 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1096711388 12:53459021-53459043 CTTAGCAAGTACATTCCTTCAGG + Intronic
1097426107 12:59446476-59446498 CCCAGGAATTGCAGTCCTCATGG + Intergenic
1097724920 12:63064468-63064490 CCAAGCAATTTCAGCCCTTCTGG + Intergenic
1098060238 12:66553981-66554003 CCTAGGAGTTGCAGTCCTTGTGG - Intronic
1098649148 12:72941936-72941958 TCCAGGAATTACAGTCCTTGTGG + Intergenic
1098705530 12:73684677-73684699 CCTAAGATTTGCAGTCCTTATGG - Intergenic
1099119149 12:78665774-78665796 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
1099524690 12:83705268-83705290 CCTATGACTTGCAGTCCTTATGG - Intergenic
1099562312 12:84193338-84193360 CCTAGGATTTTCAGTCCTTGAGG + Intergenic
1100381145 12:94063025-94063047 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1100909259 12:99339098-99339120 CCCAGGAATTACAGTCCTTGTGG + Intronic
1101226582 12:102693962-102693984 CCTAGCAGTTGCAGTTCTTGTGG - Intergenic
1104406515 12:128522048-128522070 TCTGGAAAATACAGTCCTTACGG - Intronic
1106964164 13:35038937-35038959 CCTATGAGGTACAGTCCTTATGG + Intronic
1107370245 13:39737726-39737748 CCCAGGAATTAGAGCCCTTATGG + Intronic
1107524286 13:41214475-41214497 CCTAGCAACTACAGTCCTTGTGG + Intergenic
1108137863 13:47385256-47385278 CCTAGGAGTTGCAGTCCTTATGG - Intergenic
1108595999 13:51950112-51950134 CCCCGCAATTACAGTGCTTCCGG + Exonic
1109506663 13:63311297-63311319 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1109685763 13:65818348-65818370 CCTAGGATTTGCAGTCCTTGTGG - Intergenic
1109961730 13:69639787-69639809 CCCAGGAATTGCAGTCCTTATGG + Intergenic
1110219418 13:73058299-73058321 TCTAGCAATTAAAATCCTGAAGG + Intronic
1111042701 13:82770687-82770709 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1111300439 13:86342369-86342391 CCAAGGAATTGCAGTCCTTGTGG + Intergenic
1111390757 13:87591876-87591898 CCTATGAGTTGCAGTCCTTATGG - Intergenic
1112079789 13:95957406-95957428 CCCAGGAATTCCAGTCCATAAGG - Intronic
1114761675 14:25322742-25322764 CCTAGAAATTGCAGTCCTTGTGG + Intergenic
1114988050 14:28253568-28253590 CCTAAGAGTTTCAGTCCTTATGG + Intergenic
1115820914 14:37211640-37211662 CCTAAGAGTTGCAGTCCTTATGG - Intronic
1116057786 14:39885456-39885478 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1116079327 14:40153843-40153865 CCTAGCAGTTGCAGTTCTTGTGG - Intergenic
1116192512 14:41679178-41679200 CCCAGGAATTGCAGTCCTTGTGG - Intronic
1116275689 14:42828199-42828221 CCCAGGAATTCCAGTCCTTTTGG + Intergenic
1116395230 14:44440220-44440242 CCTAGGAATGACAGAGCTTATGG + Intergenic
1116725237 14:48554490-48554512 CCTACAAATTGCAGTCCTTCTGG + Intergenic
1117161526 14:52994763-52994785 CCTAGGAATTACAGTCCTTGTGG + Intergenic
1117607073 14:57440749-57440771 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
1118431243 14:65720686-65720708 CCTAGAAATTACAGTTCTTGTGG + Intronic
1118660185 14:68000656-68000678 CCAAACAATTACAGACCTAAAGG - Intronic
1119284546 14:73442019-73442041 CCTAGCAATTCCACTACTTATGG + Intronic
1126534069 15:49741842-49741864 CCTAGCAACTGCAGTCCTTGTGG - Intergenic
1126709523 15:51441690-51441712 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1127132556 15:55882595-55882617 ACTAGGAATTGCAGTCCTTGTGG - Intronic
1129030710 15:72615776-72615798 CCTAGGAGTTGAAGTCCTTATGG + Intergenic
1129642304 15:77393196-77393218 CCCAGGAATTGCAGTCCTTGTGG - Intronic
1130511712 15:84595060-84595082 CCTAGGAGTTGAAGTCCTTATGG - Intergenic
1131631968 15:94187060-94187082 CCTAAGAGTTTCAGTCCTTATGG - Intergenic
1131950261 15:97673826-97673848 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1131959519 15:97773734-97773756 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
1132230724 15:100181891-100181913 ACTAGCAGTTTCAGTCCTTGTGG + Intronic
1133834270 16:9352097-9352119 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1134760223 16:16707934-16707956 CCTAATTATCACAGTCCTTAAGG - Intergenic
1134985849 16:18651271-18651293 CCTAATTATCACAGTCCTTAAGG + Intergenic
1138890814 16:61142243-61142265 CCTAGGAGTTACAGTCCTTGTGG + Intergenic
1138916474 16:61471129-61471151 CCTCTAAGTTACAGTCCTTAGGG - Intergenic
1142313100 16:89325548-89325570 AATAGCAACTACAGTACTTAGGG + Intronic
1142919167 17:3169564-3169586 CCTAGCAGTTTCAGTCCTTGTGG - Intergenic
1143413619 17:6728659-6728681 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1146216702 17:30982189-30982211 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
1146749842 17:35368565-35368587 CCTAGGAGTTTCAGTCCTTGTGG - Intronic
1149157440 17:53648339-53648361 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1150531732 17:65990706-65990728 CCTAGGAATTGCAGTCCTTATGG - Intronic
1150550278 17:66203683-66203705 CCTAGGAATTTCAGTCCTTGTGG - Intergenic
1151484258 17:74388713-74388735 CCTAGCATCTACAGTGCTTATGG + Intergenic
1153075399 18:1156580-1156602 CCTATGAGTTAGAGTCCTTATGG + Intergenic
1154085942 18:11305656-11305678 CCTAGGAATTGCAGTCCTCATGG + Intergenic
1154386494 18:13897438-13897460 CCTAAGAGTTACAGTCCTTGTGG - Intronic
1156021642 18:32606308-32606330 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1157879232 18:51304381-51304403 CCCAGGAATTGCAGTCCTTATGG - Intergenic
1157936895 18:51883466-51883488 TCTAGGAGTTACAGTCTTTATGG - Intergenic
1158431193 18:57389141-57389163 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1159092115 18:63861074-63861096 CCCAGGAATTGCAGTCCTTGAGG + Intergenic
1159339763 18:67119579-67119601 CCCAGAAATTGCAGTCCTTGTGG + Intergenic
1159802657 18:72920164-72920186 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1166757643 19:45203223-45203245 CCCAGAAATTGCAGTCCTTGTGG + Intronic
1167625848 19:50588662-50588684 CTTAGCACTTACATTCCCTAGGG + Intergenic
1168448992 19:56448406-56448428 CCCAGGAATTGCAGTCCTTGTGG - Intronic
925484799 2:4316295-4316317 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
925506410 2:4569665-4569687 CCAAGGAATTTCAGTCCTTGTGG + Intergenic
926473611 2:13293593-13293615 CCCAGCAATTTCAGTCTTTGTGG + Intergenic
928468083 2:31542010-31542032 CCCAGGAATTGCAGTCCTTGTGG - Intronic
928786130 2:34888078-34888100 CCTAAGAGTTACAGTCCTTATGG + Intergenic
929099904 2:38301754-38301776 CCCAGGAATTGCAGTCCTTGTGG - Intronic
929388747 2:41442964-41442986 CCTATGAGTTGCAGTCCTTATGG + Intergenic
929529320 2:42737200-42737222 CCTAGGAATTGCAGTCCTTGTGG + Intronic
930230764 2:48841633-48841655 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
930284215 2:49407866-49407888 CCTAAAAATAACAGTGCTTATGG - Intergenic
930778187 2:55196260-55196282 CCTAGGAGTTGCAGTCCTTGTGG - Intronic
931086034 2:58831483-58831505 CCTAGGAGTTACAGTCCTTGTGG + Intergenic
931572182 2:63680623-63680645 ACTAGGAATTGCAGTCCTTGTGG - Intronic
931582929 2:63796769-63796791 CCTAGGAATTGGAGTCCTTGCGG - Intronic
931736435 2:65198965-65198987 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
932889407 2:75579223-75579245 GCCAGCAATTACAGTCCCTGTGG - Intergenic
933349037 2:81128649-81128671 CCTAGGCATTGCAGTCCTTGTGG + Intergenic
935378635 2:102426095-102426117 CCTGGAAATCACAGACCTTATGG + Intronic
936511371 2:113150175-113150197 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
936884957 2:117299606-117299628 CCCAGGTATTACAGTCCTTGTGG - Intergenic
936901425 2:117485561-117485583 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
936940475 2:117879060-117879082 CCCAGGAATTATAGTCCTTGTGG + Intergenic
937560486 2:123218557-123218579 CCTAGGATTTGCAGTCCTTGTGG - Intergenic
937617496 2:123943631-123943653 CCTAAGAATTGCATTCCTTATGG - Intergenic
939144451 2:138395924-138395946 CCTAGGAGTTACGGTCCTTGTGG - Intergenic
939244899 2:139610446-139610468 CCTAGGAGTTGCAGTCCTTATGG + Intergenic
939257304 2:139760191-139760213 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
939930856 2:148231123-148231145 CCTTGGAGTTGCAGTCCTTATGG + Intronic
940315258 2:152321071-152321093 CCTAGGCATTGCAGTCCTTGTGG + Intergenic
940425264 2:153524818-153524840 CCTAGGTGTTACAGTCCTTGTGG - Intergenic
941528320 2:166632800-166632822 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
942881825 2:180870883-180870905 CCTAGGAATTGCAGTCCTTGTGG - Intergenic
942972348 2:181971639-181971661 CCAAGGAATTGCAGTCCTTGAGG + Intronic
943169935 2:184385695-184385717 CCTAGGAGTTTCAGTCCTTGTGG - Intergenic
943302643 2:186223223-186223245 ACCAGAAATTACAGTCCTTGTGG - Intergenic
944133349 2:196370597-196370619 CCCAGGAATTGCAGTCCTTGTGG + Intronic
944510428 2:200459385-200459407 ACTGGGAACTACAGTCCTTAAGG + Intronic
944550308 2:200839301-200839323 CCTAGGAATTGCAGTCCTTGTGG - Intergenic
944855174 2:203760283-203760305 CTTAGGAATTACAGTCCTTGTGG + Intergenic
944954979 2:204798461-204798483 CCCAGGAATTGCAGTCCTTGTGG - Intronic
944990609 2:205230704-205230726 CCCAGTAATTGCAGTCCTTAGGG + Intronic
945334354 2:208573722-208573744 CCCAGGAATTGCAGTCCTTGTGG - Intronic
945551667 2:211228667-211228689 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
945844902 2:214932010-214932032 CCTCTCTATTGCAGTCCTTATGG + Exonic
945987273 2:216364999-216365021 CCTAACATTTACAGGCCCTATGG - Intronic
947009247 2:225547389-225547411 CTTAGAAATTGCAGTCCTTGTGG + Intronic
947312433 2:228818761-228818783 CCTAAAAATTTCAGTCTTTATGG + Intergenic
1168748241 20:263383-263405 CCTAGGAATTGCAGTTCTTGTGG - Intergenic
1168900010 20:1355331-1355353 CCCAGGAATTGCAGTCCTTCTGG + Intronic
1170062687 20:12276086-12276108 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1170709336 20:18775897-18775919 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1172485619 20:35296235-35296257 CCTCTTAATTACAGTCATTAAGG - Intergenic
1174690959 20:52504041-52504063 CCCAGGAATTTCAGTCCTTGTGG - Intergenic
1174938449 20:54897928-54897950 CCCAGGAATTACAGCCCTTGTGG - Intergenic
1176940025 21:14912411-14912433 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1177132886 21:17279175-17279197 CCTAAGACTTTCAGTCCTTATGG - Intergenic
1177456258 21:21343810-21343832 CCTAAGAGTTGCAGTCCTTATGG - Intronic
1177494669 21:21873278-21873300 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1177849760 21:26332696-26332718 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1178216521 21:30605388-30605410 CCTAGAAGTTGCAGTCCTTATGG - Intergenic
1179395819 21:41039404-41039426 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1184448197 22:44566198-44566220 CCTAGCAATTACATTAGTTTGGG - Intergenic
949536526 3:5000318-5000340 CCTAGGGATAAAAGTCCTTAAGG + Intergenic
949623068 3:5837785-5837807 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
949733018 3:7136249-7136271 CATAGCAAATACAGTGTTTATGG - Intronic
949829355 3:8197406-8197428 CCCAGGAATTGCAGTCCTTGAGG + Intergenic
951029371 3:17863898-17863920 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
951181846 3:19668451-19668473 CCTAGGAATTGCAGTCCTTGTGG - Intergenic
951204254 3:19909488-19909510 CCTAAGAGTTCCAGTCCTTATGG - Intronic
951246663 3:20349385-20349407 CCTATAGTTTACAGTCCTTATGG + Intergenic
952132893 3:30384988-30385010 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
952811981 3:37412103-37412125 CCTAGAAATTGCAGGCCTTGTGG + Intronic
953700019 3:45188185-45188207 CCTGGCAAACACAGTCCTTGAGG - Intergenic
953958614 3:47249796-47249818 CCCTGCAATTCCAGTACTTAGGG + Intronic
954488132 3:50873617-50873639 CCTAGGAGTTACAGTCCTTGTGG + Intronic
955274461 3:57533932-57533954 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
956055519 3:65294547-65294569 CCAAGCAATTACAACCCTTCTGG + Intergenic
957085821 3:75675507-75675529 CCTAAGAGTTACAGTCCTGATGG + Intergenic
958617528 3:96514885-96514907 CCTAAGAGTTACAGTCCTTATGG - Intergenic
958670493 3:97197746-97197768 CCCAGAAATTGCAGTCCTTGTGG + Intronic
958876577 3:99624232-99624254 CCTAGGACTTGCAGTCCTTGTGG - Intergenic
959279179 3:104316527-104316549 CCTAAGAATTATAGTCCTTGTGG - Intergenic
959413943 3:106061379-106061401 CCTAAGAATTGCAGTCCTTATGG - Intergenic
959443839 3:106412782-106412804 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
959868541 3:111300122-111300144 CCCAGGAATTGCAGTCCTTGTGG + Intronic
959913808 3:111794074-111794096 CCAAGGAATTGCAGTCCTTGTGG + Intronic
960067226 3:113387111-113387133 TCTAGGAATTGCAGTCCTTATGG - Intronic
960207394 3:114918938-114918960 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
960404054 3:117238278-117238300 CCTAGGAATTGCAGCCCTTATGG - Intergenic
960471913 3:118076146-118076168 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
960521262 3:118658201-118658223 CCTAAGAGTTGCAGTCCTTACGG + Intergenic
960564839 3:119122474-119122496 CCTAGGAGTTGCAGTCCTTGTGG - Intronic
960681175 3:120249265-120249287 CCTAAGAGTTGCAGTCCTTATGG - Intronic
960862882 3:122169270-122169292 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
961610329 3:128132313-128132335 CCCAGGAATTGCAGTCCTTGTGG - Intronic
963364961 3:144323253-144323275 CCTATGAGTTGCAGTCCTTATGG - Intergenic
963447964 3:145439553-145439575 CCTACGAGTTGCAGTCCTTATGG - Intergenic
963515213 3:146300751-146300773 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
964021702 3:152021307-152021329 CCTAGGAGTTGCAGTCCTTATGG - Intergenic
964140861 3:153397232-153397254 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
964179254 3:153864515-153864537 CCTAGGAACTGCAGTCCTTGTGG - Intergenic
964349720 3:155790891-155790913 CCTAGGAATTGCAGGCCTTGTGG - Intronic
964582979 3:158260635-158260657 CCCAGGAATTACAGTTCTTGTGG + Intronic
964965127 3:162482434-162482456 CCAAGGAATTGCAGTCCTTGTGG + Intergenic
965099487 3:164278042-164278064 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
965181029 3:165404102-165404124 CCCAGGAATTACAGTTCTTGTGG - Intergenic
965264086 3:166518414-166518436 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
965350059 3:167600327-167600349 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
965867105 3:173217371-173217393 CCTAGCAGTTGCAGTCCTTGTGG + Intergenic
965996675 3:174891725-174891747 CCTAAGAGTTACAGTCCTTGTGG - Intronic
966141857 3:176766528-176766550 CCCAGGAATTACAGTCCTTGTGG - Intergenic
966151591 3:176873053-176873075 CCTAGAAGTTGCAGTCCTTGTGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967551022 3:190796261-190796283 CCTAGGTCTTGCAGTCCTTATGG - Intergenic
967967107 3:194970417-194970439 CCTAGCAATTCTATTCCCTAGGG - Intergenic
972237530 4:37151001-37151023 CCTAAGAGTTACAGTCCTTATGG + Intergenic
972272295 4:37523051-37523073 CCTAAGAGTTTCAGTCCTTATGG + Intronic
972783473 4:42306152-42306174 TCTAGCTATTACAGTAATTAAGG - Intergenic
972851513 4:43056816-43056838 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
972885215 4:43476898-43476920 CCTAAGAATTGCAGTCCTAATGG + Intergenic
973227374 4:47801825-47801847 CCTAGGAATTGCAGTCCTTGTGG - Intronic
973283915 4:48393497-48393519 CCCAGCACTTACAGGCCTTTGGG - Intronic
973784304 4:54320891-54320913 CATAGCAATTACTGACCATATGG + Intergenic
975314319 4:72933669-72933691 CCTAGAAATTGCAATCCTTGTGG + Intergenic
975365665 4:73524668-73524690 CCTAGGAATCACAGTCTTTGTGG + Intergenic
976016333 4:80559899-80559921 CCTAAGCATTGCAGTCCTTATGG - Intronic
976451964 4:85200210-85200232 TCTAAAAATTGCAGTCCTTATGG + Intergenic
976943842 4:90739533-90739555 CCCAGGAATTGCAGTCCTTGTGG + Intronic
977600092 4:98926731-98926753 CCTAGGAATTAAGTTCCTTAAGG + Intronic
978662015 4:111137970-111137992 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
978733720 4:112061557-112061579 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
979100329 4:116604350-116604372 CCTAGGAATTTCAGTTCTTGTGG + Intergenic
979111306 4:116761409-116761431 CCCAGGAATTTCAGTCCTTGTGG - Intergenic
979142843 4:117200728-117200750 CCTAGGAGTTGCAGTCCTCATGG - Intergenic
980412901 4:132446733-132446755 CCTAGGAGTTGCAGTCCTTATGG - Intronic
980442456 4:132866935-132866957 CCTAGGAATTACATTCCTTGTGG - Intergenic
981286427 4:143024392-143024414 CCCAGAAATTGCAGTCCTTGTGG - Intergenic
981298208 4:143156845-143156867 CCTAGGAGTTACAGTCCTTGTGG + Intergenic
981518448 4:145635140-145635162 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
981996074 4:150977039-150977061 CCTAGGAATTTCAGTCCTTGTGG - Intronic
982615233 4:157633208-157633230 CCTAAGAGTTACAGTCCTTATGG - Intergenic
983388840 4:167102799-167102821 CCTAGCAATTACAGTCCTTATGG - Intronic
984616643 4:181906077-181906099 CGTAGTAATTCCAGTCCTGAAGG + Intergenic
986084699 5:4433031-4433053 CCCAGCCATTGCTGTCCTTATGG - Intergenic
986085176 5:4437715-4437737 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
986155878 5:5175578-5175600 CCTAGGAATTTCAGTTCTTGTGG + Intronic
986756234 5:10839293-10839315 CCCAGCAATTGCAGTCCTTGTGG - Intergenic
987340918 5:16937877-16937899 CAGAACAATTACAGTCATTATGG + Intergenic
987564210 5:19564150-19564172 CTCAGGAATTACAGTCCTTCTGG - Intronic
988384110 5:30539372-30539394 CCCAGGAATTCCAGTCCTTGTGG - Intergenic
988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG + Intergenic
989330002 5:40245872-40245894 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
989657791 5:43762641-43762663 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
989722672 5:44548237-44548259 CTTTGCAATTTCACTCCTTATGG + Intergenic
989970844 5:50521953-50521975 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
990592796 5:57283110-57283132 CCTAGGAGTTTCAGTCCTTGTGG - Intergenic
991169443 5:63604073-63604095 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
991210554 5:64099612-64099634 CCAAGCATTTTCAGTTCTTAGGG + Intergenic
991297107 5:65093169-65093191 ACTAGGACTTACAGTCCTTGTGG - Intergenic
992531880 5:77659887-77659909 CTCAGGAATTGCAGTCCTTATGG + Intergenic
993507759 5:88732344-88732366 CCTAGAAATTACAGTCTTGCTGG - Intronic
993623234 5:90192563-90192585 CCTAGGAGTTATAGTCCTTGTGG - Intergenic
993932284 5:93954727-93954749 CCCAAGAATTGCAGTCCTTATGG + Intronic
994343716 5:98661658-98661680 CCTAGGAGTTGCAGTCCTTATGG - Intergenic
994634024 5:102321286-102321308 CCTAACAGTTGCAGTTCTTATGG + Intergenic
995278661 5:110307844-110307866 CCTAAGTGTTACAGTCCTTATGG + Intronic
996161543 5:120173272-120173294 CCTAAGAATTGCAGTCCTTACGG - Intergenic
996594392 5:125184770-125184792 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
996982756 5:129519532-129519554 CCTAAGAGTTGCAGTCCTTATGG + Intronic
997059773 5:130487729-130487751 CCAAGGAATTGCAGTCCTTGTGG - Intergenic
1000270121 5:159676536-159676558 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1000433923 5:161184939-161184961 ACATTCAATTACAGTCCTTAGGG - Intergenic
1000539391 5:162520967-162520989 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1001845298 5:174916687-174916709 CCTAGGAGTTGAAGTCCTTATGG - Intergenic
1003438041 6:6111978-6112000 CCTAGGAGTTGCAGTCCTTATGG + Intergenic
1006463069 6:34175096-34175118 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
1007001733 6:38319864-38319886 CCTAGGATTTACAGTCCTTGTGG + Intronic
1008238817 6:49083923-49083945 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1008304614 6:49886273-49886295 CCTAGGATTTGCAGTCCTTGTGG + Intergenic
1008727830 6:54442691-54442713 CCTATGAGTTACAGTACTTATGG + Intergenic
1008731865 6:54492216-54492238 CCTAGAATTTGCAATCCTTATGG + Intergenic
1009771302 6:68145659-68145681 CCTAGGACTTGCAGTCCTTTTGG + Intergenic
1009978752 6:70701434-70701456 CCTAGGGATTGCAGTCCTTGTGG + Intronic
1010324687 6:74550753-74550775 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1010324988 6:74554305-74554327 CCTATGACTTTCAGTCCTTATGG - Intergenic
1011018884 6:82788832-82788854 CTCAGGAATTGCAGTCCTTATGG - Intergenic
1011270987 6:85579835-85579857 CCTAGGCGTTACAGTCCTTGTGG - Intronic
1011322904 6:86116500-86116522 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
1011340916 6:86313442-86313464 CCTAGGAGTTTCAGTCCTTGTGG - Intergenic
1011386376 6:86802486-86802508 CCTAGGACTTGCAGTCCTTGTGG + Intergenic
1012073828 6:94657954-94657976 CCCAGGAATTTCAGTCCTTGTGG + Intergenic
1012174842 6:96068302-96068324 CCTAGAAATAACAATACTTAAGG + Intronic
1012297738 6:97546025-97546047 CCTAGAAAGTGCAGTCCTTGTGG + Intergenic
1012824209 6:104126592-104126614 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1013687368 6:112601106-112601128 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1013938223 6:115626313-115626335 CTTAGGAACTACAGTCCTTGAGG - Intergenic
1014692357 6:124577631-124577653 CCCAGGAATTGCAGTCCTTGTGG - Intronic
1014794631 6:125710537-125710559 CCTAGGAGTTGCAGTCCTTTTGG - Intergenic
1014840875 6:126218778-126218800 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1015030222 6:128586181-128586203 CCTAAAAGTTGCAGTCCTTATGG - Intergenic
1015392862 6:132702441-132702463 CCTAGGAATTGTAGTCCTTGTGG - Intronic
1015863262 6:137702363-137702385 CCTAGCACTTAGAGTCTTTCAGG + Intergenic
1016194541 6:141317757-141317779 CCTAGGAATTGCAGCCCTTGTGG - Intergenic
1016457436 6:144245535-144245557 CCTAGGAATTGCAGTTCTTGTGG + Intergenic
1017679574 6:156849760-156849782 CTTACCAACTACGGTCCTTAAGG - Intronic
1020485479 7:8715016-8715038 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
1021602479 7:22378140-22378162 TCTAGCAATTACAGTTTTGAGGG + Intergenic
1021640891 7:22735263-22735285 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1022542061 7:31146599-31146621 CCTAGGAATTGCAGTCCTTATGG + Intergenic
1023240900 7:38146433-38146455 CCTGGAAATTGAAGTCCTTATGG - Intergenic
1023646187 7:42318482-42318504 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1024956441 7:54926311-54926333 CCTAGAAATTGCAGTCCTTGTGG - Intergenic
1025137857 7:56435803-56435825 CCTAGTAGTTGCAGTCCTTATGG - Intergenic
1027405480 7:77855551-77855573 CCTAAGAATTGCAGTCCTTGTGG + Intronic
1027604788 7:80287533-80287555 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1027674348 7:81141322-81141344 TCTAGAAACTACAGTCCTTGTGG - Intergenic
1028160841 7:87483350-87483372 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1028207638 7:88034607-88034629 CTTAGGAGTTGCAGTCCTTATGG + Intronic
1028264540 7:88706202-88706224 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1028299631 7:89181266-89181288 CCTAGGAATTGCATTCCTTGTGG + Intronic
1028353491 7:89878786-89878808 CCCAGGAATTGCAGTCCTTGTGG + Intergenic
1028354402 7:89888125-89888147 CCTAGGAATTGCGGTCCTTCTGG + Intergenic
1028522110 7:91742827-91742849 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
1029797407 7:102909963-102909985 CCTAAGGGTTACAGTCCTTATGG + Intronic
1030408417 7:109143727-109143749 CCTACAAGTTGCAGTCCTTATGG + Intergenic
1030665472 7:112273135-112273157 CCCAGTAATTGCAGTCCTTGTGG + Intronic
1030990255 7:116291084-116291106 CCCAGAAATTGCAGTCCTTGTGG - Intronic
1031280870 7:119797728-119797750 CCTAGGAGTTGCAGTCTTTATGG + Intergenic
1031306177 7:120130550-120130572 CCCAGAAATTGCAGTCCTTGTGG - Intergenic
1031353554 7:120763653-120763675 CCCAGGAATTACAATCCTTGTGG + Intergenic
1031458987 7:122022097-122022119 CGTACCAATAACAGTCCTAATGG + Intronic
1031721835 7:125186862-125186884 CCTAGGAATTACAGTCCTCATGG - Intergenic
1031746610 7:125506246-125506268 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1031905664 7:127457708-127457730 CCCAGGAATTTCAGTCCTTATGG - Intergenic
1032726984 7:134599344-134599366 CCTAAGAATTGCAGTCCTTGTGG + Intergenic
1033499824 7:141936628-141936650 CCTAGGAGTTGCAGTCCTTGTGG - Intronic
1033877745 7:145842986-145843008 CACAGGAATTGCAGTCCTTATGG + Intergenic
1034762666 7:153687709-153687731 CCTAGAAATGTCAATCCTTAAGG + Intergenic
1034950529 7:155293822-155293844 CCTTGCAAGAACAGTCCTTTGGG - Intergenic
1035084631 7:156247502-156247524 CCTTGGAGTTGCAGTCCTTATGG + Intergenic
1035585139 8:767046-767068 CCTAGAAGTTACAGTGCTTGAGG - Intergenic
1036814901 8:11894797-11894819 CCTAGGATTTGCAGTCCTTGTGG + Intergenic
1037213849 8:16425292-16425314 CCTAGGAGTGGCAGTCCTTACGG + Intronic
1037476817 8:19265869-19265891 CCTAACACTTACAAACCTTAGGG + Intergenic
1037832483 8:22197613-22197635 CCCAGTCATTACAGTCCTGAGGG - Intronic
1038408773 8:27342151-27342173 CTTTGCAATTCCATTCCTTAGGG + Intronic
1038676724 8:29629621-29629643 CATAGCAAGTACAGTGATTAAGG + Intergenic
1040397736 8:47015452-47015474 CCTAGGCATTGTAGTCCTTATGG + Intergenic
1041606849 8:59792267-59792289 CCTAGGAATTGTAGTCCTTGTGG - Intergenic
1042297850 8:67242141-67242163 CCTAGGAGTTGCAGTCCTTGTGG - Intronic
1042972180 8:74421627-74421649 CTTACAAATTACAGTCCTGAAGG - Intronic
1043041994 8:75275453-75275475 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1043080008 8:75755052-75755074 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1043340344 8:79230062-79230084 CCTAAGAATTTCAGTCCTTATGG + Intergenic
1043554110 8:81409945-81409967 CCTAGGAGTTGCAGTCCTTATGG - Intergenic
1043567240 8:81561869-81561891 CCTGGGAATTGCAGTCCTTATGG - Intergenic
1044241383 8:89892687-89892709 CCCAGGAATGGCAGTCCTTATGG - Intergenic
1044497298 8:92902152-92902174 CCAAGGAATTGCAGTCCTTGTGG + Intronic
1045427397 8:102080725-102080747 CCTTGCAATCACAGTTTTTATGG - Intronic
1045800577 8:106096618-106096640 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1046215583 8:111141377-111141399 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
1046268264 8:111859373-111859395 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1046448432 8:114356749-114356771 CCTAAGAATTGCAGTCCTTATGG - Intergenic
1046557219 8:115790164-115790186 CCTAGAAATTGCAGTCCTTGTGG - Intronic
1047910041 8:129518128-129518150 CCTAGGAGTTACAGTCCTTGTGG - Intergenic
1048646591 8:136427867-136427889 CCTAGAAATTGCAGTCCTTGTGG - Intergenic
1050949293 9:11567368-11567390 ACTAGGACTTGCAGTCCTTATGG + Intergenic
1051306642 9:15717407-15717429 CCTAGGAGTTGCAGTCCTTGTGG - Intronic
1051842421 9:21413754-21413776 CTTAGAAATTACAGTCCTTGTGG + Intronic
1051923881 9:22299581-22299603 CCTAGAAGTTGCAGTCCTTATGG + Intergenic
1051966722 9:22836728-22836750 CCTTGGAATTGCAGTCCTTGTGG + Intergenic
1052258874 9:26491565-26491587 CCTAAGAATTGCAGTCCTTATGG + Intergenic
1052585636 9:30424717-30424739 CCTAGGAGTTTCAGTCCTTGAGG - Intergenic
1052585817 9:30425928-30425950 CCTAGGAGTTTCAGTCCTTGAGG - Intergenic
1053543398 9:38997973-38997995 CCCAGCAATAACAGTCTTTGTGG - Intergenic
1053807830 9:41821481-41821503 CCCAGCAATAACAGTCTTTGTGG - Intergenic
1054622762 9:67365947-67365969 CCCAGCAATAACAGTCTTTGTGG + Intergenic
1055227285 9:74014794-74014816 CCTAGAATTTACAGTACTTGTGG - Intergenic
1055826939 9:80338734-80338756 CCTAGGAATTGCAATCCTTGTGG - Intergenic
1056240691 9:84643737-84643759 CCTAACAAATACAGACCTCAAGG - Intergenic
1056516693 9:87359027-87359049 CCCAGGAATTATAGTCCTTATGG - Intergenic
1058226612 9:102371872-102371894 CCTAAAAATTGCAGTCCTTAGGG + Intergenic
1059859935 9:118448516-118448538 CCAGGCACTTACAGTTCTTATGG - Intergenic
1060122751 9:121010081-121010103 CCTAGAAATTGCAGTCCTTGTGG - Intronic
1061314671 9:129787542-129787564 CCCAGCAATTACAGTCCAGTGGG - Intergenic
1187652154 X:21420952-21420974 CCTAGGATTTGCAGTCCTTGTGG + Intronic
1187844840 X:23524620-23524642 CCTAGGGGTTACAGTCCTTGTGG - Intergenic
1188118635 X:26277551-26277573 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
1188161976 X:26815183-26815205 CCCAGGAATTGCAGTCTTTATGG + Intergenic
1188425076 X:30036939-30036961 CCTAGGAATTGCAGTCATTGTGG + Intergenic
1188788112 X:34373967-34373989 CCTAAGATTTGCAGTCCTTATGG - Intergenic
1189593769 X:42543037-42543059 CCTAGGACTTGCAGTCCTTGTGG - Intergenic
1189770155 X:44417252-44417274 CCTAGGAGTTGCAGTCCTTGTGG + Intergenic
1189869942 X:45371136-45371158 CCTACAAATTTCAGTCCTTGTGG - Intergenic
1189875769 X:45434277-45434299 CCTAAGAATTGCAGTCCTTGTGG + Intergenic
1189890137 X:45592194-45592216 CCTAGTAGTTACAGTCCTTGTGG + Intergenic
1190015015 X:46819431-46819453 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1190122440 X:47673014-47673036 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
1190374160 X:49773276-49773298 TCTAACAGTTACTGTCCTTAAGG - Intergenic
1190594433 X:52038624-52038646 CCTAGGAATTGTAGTCCTTGTGG - Intergenic
1191198548 X:57751855-57751877 CCTAGGATTTTCAGTCCTTGTGG - Intergenic
1191812473 X:65203806-65203828 CCCAGGAATTCCAGTCCTTATGG + Intergenic
1192020367 X:67384763-67384785 CCTAGGAATTGCAGTCTTTGTGG - Intergenic
1192614800 X:72608497-72608519 CCCAGGAATTGCAGTCCTTGTGG + Intronic
1192714842 X:73628360-73628382 CCTAAAAGTTTCAGTCCTTATGG + Intronic
1192726019 X:73752880-73752902 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1192826805 X:74705300-74705322 CCTAGCAGTTGTAGTCCTTGTGG + Intergenic
1192853202 X:74979998-74980020 CCTAGAAGTTGCAGTCATTATGG - Intergenic
1192872607 X:75199104-75199126 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1193088316 X:77467607-77467629 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1193147584 X:78093156-78093178 CCTAAGAGTTGCAGTCCTTATGG + Intronic
1193167958 X:78302994-78303016 CCTAGGAGTTGCAGTCCTTGTGG + Intronic
1193175082 X:78383674-78383696 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1193191204 X:78573082-78573104 CTTAGGAATTGCAGTCCTTCTGG + Intergenic
1193204935 X:78736928-78736950 CCTAACAGTTGCAATCCTTATGG + Intergenic
1193213762 X:78838923-78838945 CCTAGGATTTGCAGTCCTTGTGG - Intergenic
1193219738 X:78910251-78910273 CCTAGTATTTGCAGTCCTTGTGG + Intergenic
1193396532 X:80990462-80990484 CCTAAGAATTGCAGTCCTTGTGG - Intergenic
1193463572 X:81818668-81818690 CCTAGGAATTGCAGTCCCTGTGG + Intergenic
1193487395 X:82103304-82103326 CCTACAACTTACAGTTCTTATGG + Intergenic
1193619638 X:83736682-83736704 CCTAAGAGTTACAGTTCTTATGG - Intergenic
1193738324 X:85186417-85186439 ACCAGCAATTTCAGTCCTTTTGG + Intergenic
1193755994 X:85409003-85409025 CCTAAGAATTACAGTCTTTATGG + Intergenic
1193756853 X:85419162-85419184 CCCAGAAATTGCAGTCCTTGTGG + Intergenic
1193815652 X:86102071-86102093 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1193912110 X:87318040-87318062 CCTAGAAGTTTCAGTCCTTATGG + Intergenic
1193930242 X:87543778-87543800 CCTATGAGTTGCAGTCCTTATGG - Intronic
1193986888 X:88253198-88253220 CCTAGGAATTACAGTCCCTCCGG + Intergenic
1194157932 X:90416044-90416066 CCTAAGAGTTACAGTCCTTATGG + Intergenic
1194307065 X:92260165-92260187 CCTAAGAGTTGCAGTCCTTATGG + Intronic
1194338779 X:92682882-92682904 CCTAGGACTTGCAGTCCTTATGG + Intergenic
1194387697 X:93277724-93277746 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1194568361 X:95522012-95522034 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1194595069 X:95847715-95847737 CCTAAGAGTTACAGTGCTTATGG - Intergenic
1194788633 X:98118448-98118470 CCTAGACATTGCAGTCCTTGTGG - Intergenic
1194823337 X:98531778-98531800 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1194831734 X:98631766-98631788 CCTAGGTTTTACAGTCCTTGTGG - Intergenic
1194835187 X:98672823-98672845 CCTAAGAGTTACAGTCCTTATGG + Intergenic
1194857957 X:98956993-98957015 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1194920352 X:99758120-99758142 CCTAAGACTTGCAGTCCTTATGG - Intergenic
1194954665 X:100165109-100165131 CCTACAAGTTGCAGTCCTTATGG - Intergenic
1195014750 X:100766914-100766936 CCTAGGAGTTATAGTCCTTGAGG + Intergenic
1195090204 X:101451136-101451158 CCTAGGAATTGCAGTCCTTTTGG + Intronic
1195115665 X:101695936-101695958 CCTAGGAATAGCAGTCCTTGTGG - Intergenic
1195477405 X:105302816-105302838 CCCAGGAATTGCAGTCCTTGTGG + Intronic
1195543404 X:106088019-106088041 CCTAGGAATTGCAGTCCTTGTGG + Intergenic
1195595368 X:106682933-106682955 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1195984641 X:110615531-110615553 CCTAGGATTTGCAGTCCTTGTGG + Intergenic
1196096844 X:111809225-111809247 CCAAGGAATTGCAGTCCTTGTGG + Intronic
1196399623 X:115300263-115300285 CCTAAGAGTTGCAGTCCTTATGG + Intronic
1196498132 X:116346611-116346633 CCTAAGATTTGCAGTCCTTATGG + Intergenic
1196625214 X:117870513-117870535 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1196639163 X:118038726-118038748 CCTAGGAATTGCAGTCCTAGTGG - Intronic
1196865270 X:120065636-120065658 CCTAAAAGTTGCAGTCCTTATGG - Intergenic
1196877823 X:120170644-120170666 CCTAAAAGTTGCAGTCCTTATGG + Intergenic
1196984623 X:121254373-121254395 CCTAAGATTTGCAGTCCTTATGG + Intergenic
1197011506 X:121570177-121570199 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1197028405 X:121783182-121783204 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1197348179 X:125350101-125350123 CCTAAGAATTGCAGTTCTTACGG - Intergenic
1197380902 X:125737300-125737322 CCTAGAAATTGCAGTTCTTGTGG + Intergenic
1197476681 X:126933574-126933596 CCTAGGAATTGCAGTCCTTATGG + Intergenic
1197535988 X:127689912-127689934 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1197581298 X:128287829-128287851 CCTAAGATTTACAGTCCTTATGG - Intergenic
1198578433 X:138036609-138036631 CCTAGTATTTACCGTCCTTGTGG - Intergenic
1198788096 X:140313404-140313426 CCTAGGAGTTGCAGTCCTTGTGG - Intergenic
1198818159 X:140614919-140614941 CCTATGAGTTGCAGTCCTTATGG + Intergenic
1198947648 X:142032001-142032023 CCTAGGAGTTGCTGTCCTTATGG + Intergenic
1199048174 X:143202611-143202633 CCTAAGAATTGCAGTCTTTATGG + Intergenic
1199197406 X:145047714-145047736 CCTAGTAATTGCAGTACTTGTGG - Intergenic
1199239064 X:145525826-145525848 CCTACGATTTGCAGTCCTTATGG - Intergenic
1199245992 X:145604688-145604710 CCTAAGAGTTATAGTCCTTACGG - Intergenic
1199358238 X:146886157-146886179 CCTAAGAGTTGCAGTCCTTATGG - Intergenic
1199374340 X:147089015-147089037 CCTAAGAATTGCAGTCCTTATGG + Intergenic
1199439741 X:147854658-147854680 CCTATGAGTTGCAGTCCTTATGG + Intergenic
1199455272 X:148020964-148020986 CCTAAGAATTGCAGTCCTTGTGG + Intronic
1199568874 X:149247028-149247050 CCCAGAAATTGCAGTCCTTGTGG + Intergenic
1199795430 X:151191293-151191315 CCCAGGAATTGCAGTCCTTATGG - Intergenic
1199845186 X:151687803-151687825 CCCAGGAATTGCAGTCCTTGTGG - Intergenic
1200364341 X:155645383-155645405 CCTAGGAGTTACAGTCCTTGTGG + Intronic
1200504256 Y:3993013-3993035 CCTAAGAGTTACAGTCCTTATGG + Intergenic
1200582290 Y:4964390-4964412 CCTAAGAGTTGCAGTCCTTATGG + Intergenic
1200592108 Y:5087706-5087728 CCTAAGAATTGTAGTCCTTATGG + Intronic
1200647169 Y:5799662-5799684 CCTAGGACTTGCAGTCCTTATGG + Intergenic