ID: 983389395

View in Genome Browser
Species Human (GRCh38)
Location 4:167110019-167110041
Sequence CAAGCAAATACCCTAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983389395_983389398 18 Left 983389395 4:167110019-167110041 CCTCTCTCTAGGGTATTTGCTTG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 983389398 4:167110060-167110082 AAGCCACATCTAACCCTCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 95
983389395_983389400 20 Left 983389395 4:167110019-167110041 CCTCTCTCTAGGGTATTTGCTTG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 983389400 4:167110062-167110084 GCCACATCTAACCCTCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 87
983389395_983389399 19 Left 983389395 4:167110019-167110041 CCTCTCTCTAGGGTATTTGCTTG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 983389399 4:167110061-167110083 AGCCACATCTAACCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983389395 Original CRISPR CAAGCAAATACCCTAGAGAG AGG (reversed) Intronic
909240788 1:73210430-73210452 CAAACAGATACCCTACAGATGGG + Intergenic
909272485 1:73641762-73641784 CCAGAAAATATCCTAGAGAATGG - Intergenic
912648910 1:111421116-111421138 AAAGAAAATATCCCAGAGAGTGG + Intronic
915065552 1:153221489-153221511 AAAGAAAATACCCAAGGGAGTGG + Intergenic
916574039 1:166051336-166051358 CAAGGAAAGGCCCTTGAGAGAGG - Intergenic
917032952 1:170714975-170714997 CAAGAAAATACACAAGAAAGAGG - Intronic
917820887 1:178762785-178762807 TAATCAGATACCCTAGAGAATGG - Intronic
919040281 1:192378728-192378750 CAAGGAAATAGGCAAGAGAGAGG - Intergenic
919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG + Intronic
921855040 1:219973079-219973101 CAAGTAAAAAACCCAGAGAGTGG + Intronic
1066191055 10:33056635-33056657 CATGCAAAGATCCAAGAGAGGGG - Intergenic
1069373997 10:67775419-67775441 TACGCAAATACCCTAGAAAAAGG + Intergenic
1072365478 10:94704292-94704314 CAACAAAACACCCTAAAGAGAGG - Intronic
1074441241 10:113479119-113479141 CTATCAAATAGCCTAGAGTGGGG - Intergenic
1076310438 10:129502461-129502483 AAAGCAAATACCACAGAGAAAGG - Intronic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1084913972 11:72413974-72413996 CAAGCAAGGACCCTAGAGGAAGG + Intronic
1085701234 11:78747644-78747666 CAAGCAAATCCCACAGTGAGGGG - Intronic
1089317444 11:117601592-117601614 AATGCAAATACCCCTGAGAGAGG + Intronic
1089974478 11:122720551-122720573 CAAGGGAACACCCTAGAGACAGG - Intronic
1093759518 12:22891898-22891920 TAAGCAGACACCCTACAGAGTGG - Intergenic
1094227255 12:28059918-28059940 CAAGAAAATACCATGGAGAGGGG - Intergenic
1099652754 12:85449487-85449509 CAAGCAAATGTCCTAAAGAAAGG - Intergenic
1101776213 12:107796494-107796516 CAAACAGATAGCCTACAGAGTGG + Intergenic
1103702322 12:122854372-122854394 CAAGCAAAAAACTTAGTGAGTGG + Intronic
1106079538 13:26488659-26488681 TAAGCATATGCCCCAGAGAGCGG + Intergenic
1106101966 13:26701395-26701417 CAAGCAAACACCCGAGATAAGGG - Intergenic
1107101925 13:36602452-36602474 CAAGCCAATGCCATAGAGATTGG - Intergenic
1109421055 13:62113225-62113247 CATACAAACACTCTAGAGAGTGG - Intergenic
1112103891 13:96219343-96219365 AAAGCAAATAACTAAGAGAGTGG - Intronic
1113224110 13:108140470-108140492 AAAGCATAAACCATAGAGAGAGG - Intergenic
1113246262 13:108399073-108399095 CAAAGAAATAGCCTAGAAAGTGG + Intergenic
1114267198 14:21079768-21079790 TAAGCCAATATCCTAGAGATGGG + Intronic
1115418694 14:33167300-33167322 CATTCAAATCTCCTAGAGAGAGG + Intronic
1117287282 14:54298696-54298718 CAAGGGAATGCCCTGGAGAGAGG + Intergenic
1117549542 14:56820264-56820286 AAAGCAAATAAAATAGAGAGGGG - Intergenic
1118074344 14:62281910-62281932 CAACCTAATACCAGAGAGAGAGG - Intergenic
1118695641 14:68382303-68382325 TTAGCAAATACCCTGGGGAGTGG + Intronic
1120029023 14:79619140-79619162 TAAGCAGATAACCTAGAGAATGG - Intronic
1124857546 15:33405359-33405381 CAGGGAAAATCCCTAGAGAGGGG - Intronic
1127680358 15:61289778-61289800 CAAGAAAATACACTAGGGAAAGG + Intergenic
1127715791 15:61648134-61648156 CAAGCACCTACCTTAGAGGGTGG + Intergenic
1128371327 15:67041520-67041542 CTAGCAAGTATCCTAGAGACAGG + Intergenic
1129046551 15:72739670-72739692 CAAGAAAAAACCCAGGAGAGTGG + Intergenic
1130694683 15:86119076-86119098 CAAGCCAATAATCTAGAGAAAGG - Intergenic
1131074954 15:89489671-89489693 TAGGCAAAGACCCTAGAGTGTGG - Intronic
1138247233 16:55477024-55477046 CAAGGCAATACAATAGAGAGTGG + Intronic
1141026496 16:80553746-80553768 CAAGGAAATACACTAGTGAAGGG + Intergenic
1141332499 16:83124441-83124463 TAAGCAGATAACCTAGAGAATGG - Intronic
1143330666 17:6132653-6132675 GAAGAAAATAACCCAGAGAGAGG + Intergenic
1146414842 17:32622240-32622262 CAAGCAAGGACCATAAAGAGGGG - Intronic
1147616014 17:41828297-41828319 CAGGCAAACACCAAAGAGAGAGG + Intronic
1149147073 17:53506894-53506916 CAAGCATATACCCAAAAGAAAGG - Intergenic
1149498607 17:57134761-57134783 CAAGCAAATACTATAGATAGAGG + Intergenic
1150051217 17:61965105-61965127 CAAGCAAATACAGTTCAGAGTGG - Exonic
1150145693 17:62767145-62767167 CAAGCAAATGTGATAGAGAGTGG + Intronic
1150660371 17:67070656-67070678 AAAATAAAAACCCTAGAGAGTGG + Exonic
1153521954 18:5962163-5962185 CATGCTAACACCCTTGAGAGAGG + Intronic
1157577571 18:48753953-48753975 CCAGCAAATACAGAAGAGAGAGG + Intronic
1158290773 18:55939454-55939476 CAATCAAATACACTAGAGTGAGG - Intergenic
1162475338 19:10896271-10896293 GAAGAAAATACACTAGAGAATGG - Intronic
1163102825 19:15108128-15108150 CAAACAGAGACCCTAGAGGGTGG + Intronic
1164619857 19:29688419-29688441 TAGGCATATACCCAAGAGAGTGG - Intergenic
926076110 2:9944339-9944361 CAAGCAAACACCCCAAACAGGGG - Intergenic
926854450 2:17238706-17238728 GAAATAAATACACTAGAGAGAGG + Intergenic
928202646 2:29259472-29259494 AAAGTAAATTCCTTAGAGAGGGG + Intronic
930274506 2:49295967-49295989 AAAGCAGATTCCCTTGAGAGGGG + Intergenic
931405964 2:61978595-61978617 CAAGCAAACACCTTAAGGAGAGG - Intronic
935453017 2:103232859-103232881 CAAGCAACAACCCAAGTGAGAGG - Intergenic
937181785 2:120003026-120003048 CAACAAAACACCCTAGAGAAGGG - Intergenic
937586718 2:123560515-123560537 CAAACAGATAACCTACAGAGTGG - Intergenic
938154760 2:128925044-128925066 GCAGCAAATGCCCTAGAGAAGGG - Intergenic
940921927 2:159317120-159317142 AAAGCAAATAACCTTGAAAGAGG + Intergenic
942082424 2:172413234-172413256 AAAGCAAATTCCCAAGAGTGAGG + Intergenic
1170055052 20:12192790-12192812 CAAGAAAAAACCCTGGTGAGGGG - Intergenic
1174705564 20:52652453-52652475 CAAGGGAATTCCCTAGAAAGGGG + Intergenic
1174861338 20:54094342-54094364 TATGCAAATACCTTAGGGAGTGG + Intergenic
1178393293 21:32216983-32217005 CAAGAACAAACCCTGGAGAGGGG + Intergenic
1179003639 21:37487998-37488020 TAAGCAAATACTCAAGAGTGAGG - Intronic
1185213553 22:49585865-49585887 GATGCAAACACCCTTGAGAGGGG + Intronic
950425244 3:12921567-12921589 GTAGCACATACCCTAGAAAGAGG - Intronic
951284461 3:20791616-20791638 CAATCACATTCCCTAGGGAGAGG + Intergenic
952700206 3:36319725-36319747 AATGCACACACCCTAGAGAGGGG - Intergenic
952959307 3:38579690-38579712 CAAGCAAAGGGCCTAGAGACAGG + Intronic
958823872 3:99007177-99007199 CAGTCACATCCCCTAGAGAGGGG - Intergenic
960234120 3:115261689-115261711 AAAGCAGAAACCCTACAGAGAGG - Intergenic
960424820 3:117493424-117493446 CAAAAAAATACCTTAGAGACTGG - Intergenic
960955891 3:123030373-123030395 CAAGCAAACAAGCTAAAGAGCGG + Intergenic
963634324 3:147775545-147775567 CAAGGAAACACGATAGAGAGTGG + Intergenic
966090895 3:176134591-176134613 CAAGAAAATACATTAGAGAAAGG - Intergenic
968655650 4:1777444-1777466 CAAGCAGAAACCCTAGGAAGGGG - Intergenic
968768838 4:2490231-2490253 TAAGCAAATAACCTAGGGACAGG + Intronic
970960778 4:21869105-21869127 CAAGCAAATAGGATAGAGAATGG - Intronic
974675919 4:65089663-65089685 CAGTCACATACCCTAGGGAGGGG - Intergenic
977875525 4:102145344-102145366 TAAGCAGATAACCTAGAGAATGG - Intergenic
978132663 4:105218115-105218137 AAAGCAAGTACCCTGGACAGTGG - Intronic
978344060 4:107747854-107747876 CTAATAAATATCCTAGAGAGTGG + Intergenic
979555945 4:122047715-122047737 CAAGCATAAGCCCCAGAGAGTGG - Intergenic
980677859 4:136113380-136113402 CACGCAAGTATCCTGGAGAGAGG + Intergenic
982239904 4:153289205-153289227 CAACAAAAAACCCTAGGGAGAGG - Intronic
982281449 4:153687246-153687268 CAAGCAAATACCTTAAAAACTGG + Intergenic
982564768 4:156972292-156972314 CTAGCAAAGACCTTAGGGAGTGG - Intergenic
983122531 4:163904694-163904716 CAAGTAAAAAACCTAGAGAGTGG - Intronic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
986584359 5:9299418-9299440 CAAGCAAACACCCAGGAGAAAGG + Intronic
993209099 5:84924612-84924634 CATGCAAATGCACTAGATAGAGG - Intergenic
993837239 5:92830416-92830438 CAAACAAACAACCTATAGAGTGG - Intergenic
995458377 5:112376059-112376081 TAAGCAAAAACCCTAGGAAGAGG + Intronic
996698985 5:126430097-126430119 AAAGCAAAGATCCTTGAGAGAGG + Intronic
999592173 5:153160070-153160092 GAGGTAAATACCCTTGAGAGAGG + Intergenic
1000709714 5:164557120-164557142 CAAGCAGACAACCTAGAGAATGG - Intergenic
1001040197 5:168329084-168329106 AAACCAAGTACCCTACAGAGGGG - Intronic
1001829521 5:174773914-174773936 CAAGCCCATTCCCAAGAGAGAGG - Intergenic
1005427366 6:25716856-25716878 CAAGCAAATCCCCCCCAGAGGGG + Intergenic
1006735719 6:36271054-36271076 AATGCAAATACCCTTGGGAGAGG + Intronic
1009593937 6:65710073-65710095 TAAACAAATACCCTACAGAATGG + Intergenic
1015363554 6:132370911-132370933 CAAGCAAATATCCTACATAGAGG + Intronic
1015682973 6:135828458-135828480 CAGGCAAAGAACCTGGAGAGAGG + Intergenic
1016471508 6:144379495-144379517 CACTCAAGCACCCTAGAGAGAGG - Intronic
1016682600 6:146848223-146848245 CAAGAAAATATCCTCAAGAGAGG - Intergenic
1018040723 6:159919578-159919600 CAAGAAAAGAACCGAGAGAGTGG + Intergenic
1022193768 7:28043634-28043656 TAGGTAAATACCCAAGAGAGTGG + Intronic
1022984834 7:35642018-35642040 TAAACAAATACCCTACAGAATGG + Intronic
1023785336 7:43702014-43702036 TAAACAGATACCCTACAGAGTGG - Intronic
1026869008 7:73839678-73839700 AAAGCAAAAACCTTAGAGACAGG + Intronic
1027143287 7:75676087-75676109 CAAGAACAAACCCTACAGAGGGG - Intronic
1028359160 7:89947177-89947199 CTAGCAAAGACCAGAGAGAGTGG - Intergenic
1029839309 7:103345255-103345277 CAATCTAACACACTAGAGAGAGG - Intronic
1029945685 7:104530356-104530378 TAAGCATATGTCCTAGAGAGTGG + Intronic
1030315562 7:108110611-108110633 CAACCAAGCACCTTAGAGAGAGG - Intronic
1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG + Intronic
1035230069 7:157460017-157460039 CAACCAAAAGCCCCAGAGAGAGG - Intergenic
1036666782 8:10750192-10750214 CATGCAAATAGCCAAAAGAGGGG - Intronic
1037388741 8:18370027-18370049 TAAGCAGATAACCTACAGAGTGG + Intergenic
1037808115 8:22069597-22069619 CGAGCATATACCCCAGAGAGTGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1039806668 8:41005724-41005746 TAAGCATATAACCTAGTGAGAGG - Intergenic
1039929508 8:41971722-41971744 GAAGAAAATAGACTAGAGAGTGG + Intronic
1047423829 8:124728154-124728176 TAGGCGAATACCCTACAGAGCGG - Exonic
1048945871 8:139446565-139446587 AAAGCAATTTCCTTAGAGAGTGG + Intergenic
1053537931 9:38944657-38944679 CTAACAAATACTCTTGAGAGGGG + Intergenic
1054628203 9:67419264-67419286 CTAACAAATACTCTTGAGAGGGG - Intergenic
1055250414 9:74296746-74296768 CAAGCAAACACACGTGAGAGGGG + Intergenic
1060264147 9:122100623-122100645 AAAGCAATTACCCTAGGGTGGGG - Intergenic
1062651378 9:137579422-137579444 CAAGCAAAGACCCTGGAAGGCGG - Intergenic
1185661410 X:1731751-1731773 CACGCAAATACCCAGGAGAGAGG - Intergenic
1186582345 X:10833730-10833752 TAAGCACACACCCTGGAGAGGGG - Intergenic
1188569247 X:31562210-31562232 CAAGCAAATACCCTTCAGTGTGG - Intronic
1189545962 X:42042924-42042946 GAAGAAAAGACCCTAGAGATGGG - Intergenic
1191729801 X:64321067-64321089 CAACAAAAAATCCTAGAGAGAGG + Intronic
1192016939 X:67341325-67341347 CATGCAAATACTCTAAATAGGGG - Intergenic
1192211229 X:69129132-69129154 CAAGCACAGACTCAAGAGAGAGG - Intergenic
1195272723 X:103248865-103248887 CAAGCAGATAGTATAGAGAGGGG + Intergenic
1195780746 X:108460907-108460929 CAAGCAAATAGAATTGAGAGAGG - Intronic
1197007936 X:121525595-121525617 CAAGAATATACACTAGAGAAAGG + Intergenic