ID: 983389697

View in Genome Browser
Species Human (GRCh38)
Location 4:167113768-167113790
Sequence GTCCATAGCCCTTGTGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983389697_983389702 12 Left 983389697 4:167113768-167113790 CCCACCGCACAAGGGCTATGGAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 983389702 4:167113803-167113825 TATCTTTTTCCATGAAGAGAGGG 0: 1
1: 0
2: 3
3: 49
4: 468
983389697_983389701 11 Left 983389697 4:167113768-167113790 CCCACCGCACAAGGGCTATGGAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 983389701 4:167113802-167113824 GTATCTTTTTCCATGAAGAGAGG 0: 1
1: 0
2: 0
3: 27
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983389697 Original CRISPR GTCCATAGCCCTTGTGCGGT GGG (reversed) Intronic
912495730 1:110089948-110089970 GGCCATAGCCCTTGGGAGATGGG + Intergenic
915648449 1:157290420-157290442 CTGCATAGCCCTTGTGGGGCAGG + Intergenic
917406403 1:174711761-174711783 CTCCTCAGCCCTTGGGCGGTTGG - Intronic
922417135 1:225431727-225431749 CTCCTCAGCCCTTGGGCGGTCGG - Intergenic
1067578759 10:47425936-47425958 CTCCATAGCCCTGGTGGGGGTGG - Intergenic
1074185400 10:111096508-111096530 GTCCATTGCCCTGGTGATGTGGG + Intergenic
1085325127 11:75600772-75600794 GTCCATAGCCTTTGTGAAATGGG + Intronic
1091395961 12:154389-154411 GTCCATAGCCCTGGGGCAGAAGG + Intronic
1095587474 12:43864256-43864278 CTCCTCAGCCCTTGGGCGGTGGG - Intronic
1104381658 12:128312888-128312910 CTCCAGAGCCCATGTGCGGGAGG - Intronic
1107425443 13:40288370-40288392 GCCCATAGCCCTTGTCCTGAGGG + Intergenic
1112563472 13:100533293-100533315 GTTCTCAGCCCTTGTGTGGTGGG + Intronic
1121426206 14:93853948-93853970 GTCCCCAGCCCTTGTGATGTGGG + Intergenic
1127426592 15:58864784-58864806 CTCCAGAGCCTTTGTGCTGTAGG + Intergenic
1128768825 15:70266898-70266920 GTCCATAGCCCACGTGCGATGGG - Intergenic
1141372700 16:83502342-83502364 GTCCACAGCCCTTGCATGGTGGG - Intronic
1145117699 17:20226941-20226963 CTCCATAGCAGATGTGCGGTGGG + Intronic
1150358090 17:64505661-64505683 TTCCAAAGCCCTGGTGCTGTTGG - Intronic
1157684749 18:49633028-49633050 GTCCCAGCCCCTTGTGCGGTAGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
926838488 2:17051511-17051533 GTACATAGCCCTTGTCCTGAAGG + Intergenic
936500460 2:113062316-113062338 GCCCACAGCCCTGGTGCTGTGGG + Intronic
939850229 2:147295608-147295630 GACCATATCTCTTGAGCGGTAGG + Intergenic
940174033 2:150859413-150859435 CTACACAGCCCTTGTGGGGTGGG - Intergenic
940779588 2:157918710-157918732 GTCAAAAGCTCTTGTGTGGTGGG - Intronic
1174525606 20:51168149-51168171 GTCCATAGCCCCTGAGCACTGGG - Intergenic
1180971186 22:19816555-19816577 TTCCCTAGCCCGTGTGCGGAGGG - Intronic
951791037 3:26484956-26484978 TTCCATAGCCCTTCTGTAGTTGG - Intergenic
954427259 3:50449934-50449956 CTCCACAGCCCTTGTGAGCTTGG - Intronic
956707372 3:72011068-72011090 GTGCATAGCCCTTCTGCACTTGG + Intergenic
960539271 3:118846387-118846409 GTCCATGTCCCTTGTGCCGGGGG + Intergenic
960868530 3:122227215-122227237 CTCCCCAGCCCTTGGGCGGTTGG + Intronic
963056014 3:141186926-141186948 GTTCAGAGCCCATGTGAGGTGGG - Intergenic
974215514 4:58841812-58841834 GTCCAGGGCCCCTGTGCTGTGGG + Intergenic
974485064 4:62494170-62494192 GTCCAAGGCCCCTGTGCTGTGGG + Intergenic
983389697 4:167113768-167113790 GTCCATAGCCCTTGTGCGGTGGG - Intronic
995714653 5:115070263-115070285 GTCCACAGCCCTACTGCTGTGGG - Intergenic
998558299 5:143147402-143147424 GACCAAAGCCCTTGTGGGGTAGG - Intronic
999247959 5:150165464-150165486 GCACAAAGCCCTTGTGCGGAGGG + Intergenic
1006008371 6:31021079-31021101 GTCCTCAGCCCGTGGGCGGTCGG - Intronic
1028509547 7:91608857-91608879 GTCCATATCCCTTGTTGGTTTGG + Intergenic
1033220862 7:139525358-139525380 GCCCATAGCCTTTGTGCAGAAGG - Intronic
1045949906 8:107839958-107839980 GTCCATAGCCCCTTTCCAGTAGG - Intergenic
1047292120 8:123540456-123540478 GTCCACAGCGCTTGGGCGCTGGG + Intronic
1051433238 9:17002184-17002206 GTCCAGAGCCCTAATGCAGTGGG + Intergenic
1056935819 9:90914185-90914207 GTCCATGGGGCTTGTGTGGTGGG - Intergenic
1057128608 9:92638143-92638165 GATCACAGCCCTTGTGCAGTGGG + Exonic
1191936837 X:66436116-66436138 CTCCACAGCCCTTGTGTGATGGG + Intergenic