ID: 983395150

View in Genome Browser
Species Human (GRCh38)
Location 4:167184699-167184721
Sequence TCTTATACTCAGAGGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983395150_983395152 18 Left 983395150 4:167184699-167184721 CCAGCTTTCCTCTGAGTATAAGA 0: 1
1: 0
2: 2
3: 18
4: 193
Right 983395152 4:167184740-167184762 ACCTTTAAAATTTCTTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983395150 Original CRISPR TCTTATACTCAGAGGAAAGC TGG (reversed) Intronic
900754446 1:4424055-4424077 TCTTATACAAAGAGGAAACCTGG + Intergenic
905932491 1:41799423-41799445 TGTTGAACTCAGAGGACAGCAGG - Intronic
906877333 1:49553339-49553361 TCCTAAACTCACAGGAAACCAGG + Intronic
907267814 1:53273419-53273441 TCTTCTTCTCTGAGTAAAGCAGG - Intronic
907594761 1:55709323-55709345 TCTAATTCTCAGAGGAAAGAGGG - Intergenic
910995464 1:93100168-93100190 TCTTACTCTCAGAGGCAAGTGGG - Intronic
911065971 1:93788854-93788876 TCTACTACTGAAAGGAAAGCAGG - Intronic
916078563 1:161217917-161217939 TCTGGTACTCAGAGGAGAGAAGG - Intronic
918285873 1:183054543-183054565 TGTTATATTGAGAAGAAAGCAGG + Intronic
919688389 1:200506111-200506133 TCTTACACCAAGAGGCAAGCGGG + Intergenic
920199122 1:204248713-204248735 TCTTGTCCTCTGAGGAAAACTGG + Intronic
921323810 1:213970837-213970859 GCTTATACTTTGAGGAAAGGAGG + Intergenic
921747803 1:218757558-218757580 TCTTCTACTCAGGCGAAAGCAGG + Intergenic
924427496 1:243966219-243966241 TTTTATACTCACAGGAAAGCTGG + Intergenic
1063652159 10:7948383-7948405 TCTTAAAATCAGACGAAGGCTGG - Intronic
1066517673 10:36182042-36182064 TCCTAAACTGAGAGGAAAGAAGG + Intergenic
1067671382 10:48325268-48325290 TCTTCTTAACAGAGGAAAGCTGG - Intronic
1071314666 10:84382953-84382975 TGTTTTACTAAGAGGAGAGCTGG + Intronic
1071406170 10:85334663-85334685 TCTAGTACTCAGTGGAAGGCAGG - Intergenic
1074001415 10:109377374-109377396 TTTTATACTCAGATTAAAGAAGG + Intergenic
1074389730 10:113046856-113046878 TCATACACTCAGAGGAAAAAAGG - Intronic
1075686215 10:124367057-124367079 ACTTTTACTCTGAGGGAAGCAGG - Intergenic
1076760756 10:132604893-132604915 TCTGAGACTCAGAGCAAAGCAGG + Intronic
1078730251 11:13966865-13966887 TCTAATTCTCACAGGAATGCTGG - Intronic
1079000511 11:16751065-16751087 TCTTATACACAGAAGAGAGACGG + Intronic
1083700373 11:64473507-64473529 TCTTATAAGCAGAGGAAATGTGG - Intergenic
1084229481 11:67740704-67740726 TCTTCTAATCAGGAGAAAGCTGG + Intergenic
1086380598 11:86248511-86248533 ACTTTTACTCAGAGGGAACCAGG + Intronic
1090351345 11:126110465-126110487 CCTTAGACTCTGAGTAAAGCTGG + Intergenic
1090543153 11:127731015-127731037 TCTTATAAGCAGAGGAAATTTGG - Intergenic
1090836320 11:130456805-130456827 TATTATACTCACAGGACTGCAGG - Intronic
1093318624 12:17683846-17683868 TCTTACATACAGAGGAAAGGTGG - Intergenic
1093326001 12:17774682-17774704 TCCTCTACTCAGAGTAAGGCAGG - Intergenic
1097184656 12:57190044-57190066 TCCTTTACTGAGAGGAAACCAGG + Intronic
1097733361 12:63153500-63153522 TTTTATATACAAAGGAAAGCAGG + Intergenic
1098720007 12:73884369-73884391 TCTGAAACTCAGAAGAAAGTTGG - Intergenic
1102385615 12:112506997-112507019 TTTTCTAATCAGAAGAAAGCTGG + Exonic
1102899777 12:116627378-116627400 TCTTATTCTAAGAAGACAGCTGG - Intergenic
1105511864 13:21058750-21058772 ACTTATATTCAAAGGAATGCTGG + Intronic
1106834132 13:33615362-33615384 GCTGATACTCAGAGGAAAACTGG + Intergenic
1107270895 13:38614753-38614775 TTTTATGCTCCAAGGAAAGCAGG + Intergenic
1107682133 13:42863068-42863090 TCCTATACTCAGAAGAAAGAAGG + Intergenic
1108033291 13:46259408-46259430 TCTTTTTCTCAGTGGATAGCAGG + Intronic
1108126838 13:47253750-47253772 CATTATACTCAAAGGCAAGCTGG + Intergenic
1108168906 13:47721301-47721323 TCTTACACTCTGAGGGAAGAGGG - Intergenic
1108348267 13:49566827-49566849 TCTTATTTTCAGAGGAGAGAAGG - Intronic
1109333770 13:60966090-60966112 TTTTATACTCTGGGGAAGGCTGG - Intergenic
1112487485 13:99833368-99833390 TCTTATTCTTAAAGGAAAGAAGG + Intronic
1113188978 13:107721985-107722007 TCTTAAACTCAAAGGCAAGAGGG - Intronic
1115268749 14:31527982-31528004 TCTTATAAGAAGAGGAAATCTGG - Intronic
1115483349 14:33884356-33884378 TCTTAGACTTACAGGACAGCAGG + Intergenic
1115813104 14:37132372-37132394 CACTATACTCACAGGAAAGCTGG + Intronic
1116065898 14:39982659-39982681 TCTTATACTGAGAGAAATGCTGG + Intergenic
1118635984 14:67749253-67749275 TTTTATAATCACAGGAAATCTGG + Intronic
1121139594 14:91529606-91529628 TGTTCTACTCAGATGAGAGCAGG + Intergenic
1121629666 14:95413083-95413105 GCTTGTCCTCAGAGGAAAGTTGG + Intronic
1202921280 14_KI270723v1_random:32164-32186 TCTGGTACCCAGAGGAAAGGGGG + Intergenic
1124353539 15:28978132-28978154 TCTTGTAGTGAGAGGAAAGCTGG - Intronic
1127332827 15:57955417-57955439 TCTGACCCTCAGAGGAAGGCTGG - Intronic
1133227798 16:4350852-4350874 TGTTATCCCCAGTGGAAAGCTGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134803590 16:17106908-17106930 CCTCATCCTCAGAGTAAAGCAGG - Exonic
1137810549 16:51349016-51349038 TCTTAGGCTCAGAGGATAGTTGG + Intergenic
1138724165 16:59117658-59117680 TCTTATACACAAAGGCAAGTTGG + Intergenic
1141758148 16:86008465-86008487 TCTGATAGTCAGACTAAAGCTGG + Intergenic
1143678522 17:8457155-8457177 TCTTCTACTCAAAAGAAAGAAGG - Intronic
1144937415 17:18911274-18911296 CCTTAAAATCAGAGGAAAGTGGG - Intronic
1149139986 17:53420672-53420694 TCTTATACACAGAAGTAAGATGG + Intergenic
1150415410 17:64984278-64984300 GCTTATTCTCAGAGGCAATCTGG + Intergenic
1155460606 18:26077955-26077977 TCATGTTCTCAGAGTAAAGCAGG + Intronic
1156153625 18:34274050-34274072 TCTTATACTTGAAGAAAAGCTGG + Intergenic
1157938201 18:51896188-51896210 TCTTATACTTAAAGGAAATGAGG - Intergenic
1160014729 18:75131850-75131872 TTTTATTTTCAGAGGAAACCTGG + Intergenic
1162947404 19:14052200-14052222 TCTCATACCCAGAGTCAAGCGGG - Exonic
1164188271 19:22892043-22892065 TTTTAACTTCAGAGGAAAGCAGG + Intergenic
1165128435 19:33617474-33617496 TCTTATACCCTGAGGAATGATGG + Intergenic
1166038750 19:40189861-40189883 ACTTATACTCAGAATGAAGCTGG + Intergenic
1167402480 19:49282099-49282121 TCTTATCCTCATAAGAAAGGAGG - Intergenic
924985702 2:267526-267548 TCCTGAACCCAGAGGAAAGCAGG + Intronic
925250295 2:2428966-2428988 TCTTACATTAAGAGGTAAGCAGG + Intergenic
926989570 2:18662992-18663014 TGTTATATTCAGAGGAAACCAGG - Intergenic
929981475 2:46684285-46684307 TCTTCTACCAAGTGGAAAGCTGG - Intergenic
930371133 2:50502525-50502547 TCTTATATTCAGAGCTAAGGAGG - Intronic
931592794 2:63903977-63903999 TCTTATACCCAGAATGAAGCTGG - Intronic
932459698 2:71874241-71874263 TCTTCCACTCAGAGGGAAGGTGG + Intergenic
932991546 2:76794247-76794269 TCTTATACTCAGAAGAGAGAAGG + Intronic
933260119 2:80123044-80123066 ACTTATCCCCAGAGGAAAGGAGG - Intronic
933335587 2:80954583-80954605 ATTTATACTCAGTGGGAAGCAGG + Intergenic
939848283 2:147274110-147274132 TCTTCTGCTCTGAGGGAAGCTGG - Intergenic
941516297 2:166483743-166483765 AATTATTCTAAGAGGAAAGCTGG + Intronic
942678071 2:178449934-178449956 TCTTAGAATTAGAGGGAAGCAGG - Intronic
943407227 2:187505178-187505200 TTTTATACTCAAAGTATAGCAGG - Intronic
944429919 2:199622223-199622245 GCTTATAGGCAGAGGAAAGTAGG - Intergenic
946979880 2:225198963-225198985 TCTTATAATAAGAGGAATGGAGG + Intergenic
1169503008 20:6179571-6179593 TCTTCAACCCAGAGGAAATCTGG + Intergenic
1170875569 20:20246872-20246894 TCTTTTTCACAGAGGAAAGAGGG - Intronic
1171121918 20:22575875-22575897 ACCTCTTCTCAGAGGAAAGCTGG + Intergenic
1172305250 20:33876057-33876079 ACTAATACACAGAGGAAAGAAGG + Intergenic
1172631967 20:36384668-36384690 TCTTACACACGGAGGAAAGCAGG + Intronic
1174979568 20:55378318-55378340 TCCTATACTCAGATGCAGGCTGG + Intergenic
1178439008 21:32583689-32583711 ACTTATTCTCAGAGCAAGGCTGG - Intronic
1178520069 21:33281976-33281998 GATTAAACTCAGAGGCAAGCAGG - Intronic
1179425402 21:41274290-41274312 TTTTAAAATCAGAGGAAAACAGG - Intronic
1182948241 22:34345298-34345320 TCTCATATTCAGAGGAAAGCAGG + Intergenic
1184655049 22:45936871-45936893 TCTTCTCCTCAGGGCAAAGCTGG + Intronic
949375910 3:3390297-3390319 TCTTCAACTCAGAGTAAAGTTGG - Intergenic
949689927 3:6624531-6624553 TCTTATACTCAGCCGTAAGCAGG + Intergenic
951538626 3:23761934-23761956 TCTTCTGCCCAGAGGAAGGCAGG + Intergenic
953465279 3:43114459-43114481 TTTTATATTCAGAGGAGTGCTGG + Intergenic
958132999 3:89453872-89453894 TTTTATAATTAGAGGAAAGAAGG - Intronic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
962244447 3:133780194-133780216 TGATAGGCTCAGAGGAAAGCAGG - Intergenic
962938666 3:140105697-140105719 TCTTACAGTCATTGGAAAGCTGG - Intronic
963649475 3:147960301-147960323 TCTTCTACTCAGAGAAAAATAGG + Intergenic
965174422 3:165313184-165313206 TCTTGTACTAAGTGGAAAGATGG + Intergenic
965198227 3:165625681-165625703 TATTTTACTCAAAGGAAAGAGGG + Intergenic
965635219 3:170773803-170773825 TGCTATACTAAGTGGAAAGCTGG + Intronic
965758346 3:172048603-172048625 TCCTATACGCAAAAGAAAGCAGG + Intronic
968171543 3:196514179-196514201 TGATATACTCAGAGGCAAACTGG + Intronic
969251096 4:5969425-5969447 ACAAATACCCAGAGGAAAGCAGG + Intronic
969824991 4:9750674-9750696 TCTTCTAATCAGGAGAAAGCTGG - Intergenic
969910868 4:10444546-10444568 TCTTATGTTGAGAGGAAATCTGG + Exonic
971009701 4:22419881-22419903 CCCTATACTCAGAGGAAAATTGG - Intronic
972377854 4:38489672-38489694 TCTTCTGCTGAGGGGAAAGCTGG - Intergenic
972591924 4:40496076-40496098 CTTTTTTCTCAGAGGAAAGCAGG - Intronic
973216196 4:47671943-47671965 GCTTTTACTCAGAAGAGAGCAGG + Intronic
975178760 4:71318701-71318723 TTGTATACTCAAAGAAAAGCTGG - Intronic
976180295 4:82392468-82392490 TCTTATACACAGAGGTGAGATGG + Intergenic
976197772 4:82550011-82550033 TCATATCCTCTGAGGAAAGGAGG + Intronic
979567135 4:122167052-122167074 TTTTCTACTAAGAGGAAAGAGGG - Intronic
980930696 4:139179613-139179635 TCTTGAACACAGAGGAAACCTGG + Intergenic
982181988 4:152757005-152757027 TATTAAACTCAGAGTAAGGCTGG - Intronic
982654470 4:158130273-158130295 GCATAGTCTCAGAGGAAAGCTGG - Intronic
983395150 4:167184699-167184721 TCTTATACTCAGAGGAAAGCTGG - Intronic
983856512 4:172653007-172653029 TTTTAAAGTCAGATGAAAGCTGG - Intronic
985323612 4:188741998-188742020 TTGTATACACAGTGGAAAGCTGG - Intergenic
986626647 5:9729104-9729126 ACTCATACTCAGAGGTTAGCTGG + Intergenic
987295284 5:16545017-16545039 CCTTATTTTGAGAGGAAAGCAGG + Intronic
987730749 5:21769495-21769517 TTCTATACTCAAAGGAAAGGAGG + Intronic
989627554 5:43444993-43445015 CCTTATTCTCTGAGGAAAGATGG - Exonic
990283120 5:54272915-54272937 TCTGAGACACAGAAGAAAGCTGG + Intronic
991937516 5:71816568-71816590 TCTTATAAGAAGAGGAAACCTGG - Intergenic
992040495 5:72825907-72825929 TCATTCACTCAGAGAAAAGCTGG + Intronic
992420596 5:76600651-76600673 TCTTAAAGCCAGTGGAAAGCAGG + Intronic
993823227 5:92646790-92646812 TATGATATTTAGAGGAAAGCAGG + Intergenic
998005469 5:138654113-138654135 TTTCATAATCAGAGGAAAACTGG - Intronic
998045670 5:138984738-138984760 CCTTATACCCAGACAAAAGCAGG + Intronic
998498589 5:142612642-142612664 TCTTATACTCAGTGAAAAACAGG - Intronic
1000350526 5:160349252-160349274 TCTTCTACTCAGAGCAGAACGGG - Exonic
1000989596 5:167898336-167898358 TATTAGACTCATTGGAAAGCTGG - Intronic
1001429085 5:171645465-171645487 TCTCATTCTCAGAACAAAGCTGG + Intergenic
1002618924 5:180472735-180472757 TTTTATACCCAGAGGACAGCTGG + Intergenic
1004195733 6:13502999-13503021 TCTTTTACTCAGGGGAGAGCTGG - Intergenic
1004921272 6:20378460-20378482 TCTTCTATTGAGTGGAAAGCTGG - Intergenic
1006589880 6:35146816-35146838 TTTTAAACTCTGGGGAAAGCTGG + Intronic
1007970274 6:46045068-46045090 TTTTACTCTCAGAGGAGAGCGGG - Intronic
1009225345 6:61015935-61015957 TCTAATACTCAGAGGGAAAGAGG - Intergenic
1009263505 6:61525596-61525618 TCTTATAAGAAGAGGAAATCTGG - Intergenic
1009674209 6:66795893-66795915 TCTTATACTCAGAAGTGAGATGG - Intergenic
1009735026 6:67665265-67665287 TTTTATATTCAGAGAAAAGTGGG + Intergenic
1011964772 6:93142040-93142062 TCTGATCCTCAGAAGAAATCTGG + Intergenic
1012294736 6:97507215-97507237 TCTTTTTCTGAGAGGAAAGGAGG - Intergenic
1012614486 6:101260038-101260060 TCTTATACTCAGAAGTGAGATGG + Intergenic
1015800592 6:137058247-137058269 CCTTATAATCAGGGGAAATCTGG + Intergenic
1016442543 6:144098661-144098683 TCTTATACACAGAGGTGAGATGG - Intergenic
1016705100 6:147097659-147097681 TCTTATCCTCAGTGGAAACCAGG + Intergenic
1017024088 6:150166501-150166523 TCATATCCCCAGAGGAAAGGAGG - Intronic
1017312240 6:152987370-152987392 TTGTATACACAGTGGAAAGCTGG + Exonic
1018199331 6:161380634-161380656 TCTTATAATTAGTGGAAAGAAGG - Intronic
1018730010 6:166641914-166641936 TCTAATAGTCAGAGGCATGCTGG - Intronic
1018794145 6:167172719-167172741 GCTTATTCTCAGAGCAAGGCTGG + Intronic
1018822177 6:167382299-167382321 ACTTATTCTCAGAGCAAGGCTGG - Intronic
1020248056 7:6446058-6446080 TCTCATGCACAGAGGAAAGCTGG - Exonic
1021603510 7:22388290-22388312 TCATGTACTCAAAGGAAAGTTGG + Intergenic
1022073067 7:26936975-26936997 TCTTATACTTACAGTAAACCTGG - Intronic
1028010586 7:85638189-85638211 TATTATATTCAGATGAGAGCTGG + Intergenic
1028164293 7:87520257-87520279 TCTTATAATAAAAGGAAAGCTGG - Intronic
1028610930 7:92710798-92710820 GCTGATACTCAGAGGAGACCCGG + Intronic
1032627722 7:133610660-133610682 TTGAATCCTCAGAGGAAAGCAGG - Intronic
1033032824 7:137844295-137844317 TCTCAAAGTCAGAGGAAAGATGG - Intronic
1033828769 7:145226620-145226642 TCTTATAGTCAGAGGCTTGCAGG - Intergenic
1034186352 7:149180113-149180135 TCTTGTTCTCAGAGAACAGCAGG + Exonic
1034715355 7:153236509-153236531 TCTTATACAAAGGGGAAATCTGG - Intergenic
1036261253 8:7242025-7242047 TCCTCTAATCAGAAGAAAGCTGG + Intergenic
1036305349 8:7597525-7597547 TCCTCTAATCAGAAGAAAGCTGG - Intergenic
1036313292 8:7700569-7700591 TCCTCTAATCAGAAGAAAGCTGG + Intergenic
1036356200 8:8045522-8045544 TCCTCTAATCAGAAGAAAGCTGG - Intergenic
1036675195 8:10825863-10825885 GCTTATATTTAGAGGAAAACGGG - Intronic
1036732466 8:11277893-11277915 CCTTATACTAAGAGGAAATTTGG - Intergenic
1037170479 8:15886085-15886107 CATGATAGTCAGAGGAAAGCAGG + Intergenic
1038067558 8:23978895-23978917 ACTTATACACAGAGGGAAGGAGG - Intergenic
1038187343 8:25287086-25287108 TTCAATACTCACAGGAAAGCAGG - Intronic
1038854508 8:31316740-31316762 GCATATGCTCAGAGAAAAGCGGG + Intergenic
1039653840 8:39376505-39376527 TTTCTTAATCAGAGGAAAGCAGG + Intergenic
1040466112 8:47696890-47696912 GCATTTGCTCAGAGGAAAGCTGG - Intronic
1041191595 8:55361105-55361127 TCTTATACTCCGCGGGGAGCTGG - Intronic
1042364884 8:67924661-67924683 TCTTATAATAAGACAAAAGCAGG + Intergenic
1045396732 8:101768289-101768311 TCTTATTCTCACAGGAAGTCTGG + Intronic
1045660545 8:104433019-104433041 TCTTATACGAAGAGGAAATTTGG + Intronic
1049119063 8:140717830-140717852 TCCTATACACAGGGGAAAGAAGG + Intronic
1049626758 8:143626802-143626824 TCTTATAAAGAGAGGAAATCTGG + Intergenic
1053097527 9:35341529-35341551 TCCTAGTCTCAGAGGGAAGCCGG - Intronic
1058950540 9:109899561-109899583 TCTTATAGTCCAAGGAAAACAGG - Intronic
1060316459 9:122515913-122515935 TCTTATATTCAGTGCAAACCAGG - Intergenic
1062252239 9:135604174-135604196 TCATAAACGCAGATGAAAGCAGG - Intergenic
1187476757 X:19618072-19618094 TCTTTTTCTAAGAGGAAAACAGG - Intronic
1191669576 X:63736464-63736486 TCTTATACTCAGAGGTGGTCAGG + Intronic
1194455054 X:94093517-94093539 TCTGATAACCAGAGGTAAGCTGG - Intergenic
1195020579 X:100823093-100823115 TTCTGTTCTCAGAGGAAAGCTGG - Intronic
1195273570 X:103256064-103256086 AATTTTACTCAGTGGAAAGCAGG - Intergenic
1197666712 X:129232032-129232054 TCTTATCCTCAGTGGAACGTGGG - Intergenic
1198220454 X:134595928-134595950 TCAAATACTCATAGGAAGGCAGG - Intronic
1198676258 X:139134362-139134384 TATTATTCTCAGAAGAAATCAGG + Intronic
1199477887 X:148266332-148266354 TCTTATACTCTGAATGAAGCAGG - Intergenic