ID: 983399458

View in Genome Browser
Species Human (GRCh38)
Location 4:167244730-167244752
Sequence AACAGGGAGGTGAGTTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983399458_983399463 -5 Left 983399458 4:167244730-167244752 CCCAGTGAACTCACCTCCCTGTT No data
Right 983399463 4:167244748-167244770 CTGTTGTTTCTCAACTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983399458 Original CRISPR AACAGGGAGGTGAGTTCACT GGG (reversed) Intergenic
No off target data available for this crispr