ID: 983399463

View in Genome Browser
Species Human (GRCh38)
Location 4:167244748-167244770
Sequence CTGTTGTTTCTCAACTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983399456_983399463 28 Left 983399456 4:167244697-167244719 CCTTGTCTGGGATATACGGATAA No data
Right 983399463 4:167244748-167244770 CTGTTGTTTCTCAACTCTTGAGG No data
983399459_983399463 -6 Left 983399459 4:167244731-167244753 CCAGTGAACTCACCTCCCTGTTG No data
Right 983399463 4:167244748-167244770 CTGTTGTTTCTCAACTCTTGAGG No data
983399458_983399463 -5 Left 983399458 4:167244730-167244752 CCCAGTGAACTCACCTCCCTGTT No data
Right 983399463 4:167244748-167244770 CTGTTGTTTCTCAACTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983399463 Original CRISPR CTGTTGTTTCTCAACTCTTG AGG Intergenic
No off target data available for this crispr