ID: 983401178

View in Genome Browser
Species Human (GRCh38)
Location 4:167268246-167268268
Sequence GTCTGGGAATGCTGCCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983401178_983401184 0 Left 983401178 4:167268246-167268268 CCTACTGGGCAGCATTCCCAGAC No data
Right 983401184 4:167268269-167268291 GATTAGGCATTCTGGGTCACAGG No data
983401178_983401182 -7 Left 983401178 4:167268246-167268268 CCTACTGGGCAGCATTCCCAGAC No data
Right 983401182 4:167268262-167268284 CCCAGACGATTAGGCATTCTGGG No data
983401178_983401186 13 Left 983401178 4:167268246-167268268 CCTACTGGGCAGCATTCCCAGAC No data
Right 983401186 4:167268282-167268304 GGGTCACAGGATGATGTAGGAGG No data
983401178_983401187 30 Left 983401178 4:167268246-167268268 CCTACTGGGCAGCATTCCCAGAC No data
Right 983401187 4:167268299-167268321 AGGAGGTCAGCACAAAATACAGG 0: 93
1: 330
2: 564
3: 589
4: 553
983401178_983401185 10 Left 983401178 4:167268246-167268268 CCTACTGGGCAGCATTCCCAGAC No data
Right 983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG No data
983401178_983401180 -8 Left 983401178 4:167268246-167268268 CCTACTGGGCAGCATTCCCAGAC No data
Right 983401180 4:167268261-167268283 TCCCAGACGATTAGGCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983401178 Original CRISPR GTCTGGGAATGCTGCCCAGT AGG (reversed) Intergenic
No off target data available for this crispr