ID: 983401181

View in Genome Browser
Species Human (GRCh38)
Location 4:167268262-167268284
Sequence CCCAGAATGCCTAATCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983401181_983401186 -3 Left 983401181 4:167268262-167268284 CCCAGACGATTAGGCATTCTGGG No data
Right 983401186 4:167268282-167268304 GGGTCACAGGATGATGTAGGAGG No data
983401181_983401187 14 Left 983401181 4:167268262-167268284 CCCAGACGATTAGGCATTCTGGG No data
Right 983401187 4:167268299-167268321 AGGAGGTCAGCACAAAATACAGG 0: 93
1: 330
2: 564
3: 589
4: 553
983401181_983401185 -6 Left 983401181 4:167268262-167268284 CCCAGACGATTAGGCATTCTGGG No data
Right 983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983401181 Original CRISPR CCCAGAATGCCTAATCGTCT GGG (reversed) Intergenic
No off target data available for this crispr