ID: 983401185

View in Genome Browser
Species Human (GRCh38)
Location 4:167268279-167268301
Sequence TCTGGGTCACAGGATGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983401181_983401185 -6 Left 983401181 4:167268262-167268284 CCCAGACGATTAGGCATTCTGGG No data
Right 983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG No data
983401183_983401185 -7 Left 983401183 4:167268263-167268285 CCAGACGATTAGGCATTCTGGGT No data
Right 983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG No data
983401178_983401185 10 Left 983401178 4:167268246-167268268 CCTACTGGGCAGCATTCCCAGAC No data
Right 983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983401185 Original CRISPR TCTGGGTCACAGGATGATGT AGG Intergenic
No off target data available for this crispr