ID: 983402685

View in Genome Browser
Species Human (GRCh38)
Location 4:167285324-167285346
Sequence GCATGGTGCTGGTGCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983402685_983402689 19 Left 983402685 4:167285324-167285346 CCTGTTTGGCACCAGCACCATGC No data
Right 983402689 4:167285366-167285388 TTGTAGTATAGTTTGAAATCAGG 0: 290
1: 14015
2: 8489
3: 6576
4: 5400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983402685 Original CRISPR GCATGGTGCTGGTGCCAAAC AGG (reversed) Intergenic
No off target data available for this crispr