ID: 983412889

View in Genome Browser
Species Human (GRCh38)
Location 4:167421310-167421332
Sequence GCCCTTCCCAGCTTGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983412889_983412894 23 Left 983412889 4:167421310-167421332 CCTAAGCTCAAGCTGGGAAGGGC No data
Right 983412894 4:167421356-167421378 CCCTCAGCAATATAAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983412889 Original CRISPR GCCCTTCCCAGCTTGAGCTT AGG (reversed) Intergenic