ID: 983413074

View in Genome Browser
Species Human (GRCh38)
Location 4:167423037-167423059
Sequence ACTGAAAGGCAGACTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983413070_983413074 -6 Left 983413070 4:167423020-167423042 CCTCATATGGAGATTTAACTGAA 0: 6
1: 4
2: 9
3: 26
4: 202
Right 983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG No data
983413068_983413074 0 Left 983413068 4:167423014-167423036 CCATGCCCTCATATGGAGATTTA No data
Right 983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG No data
983413069_983413074 -5 Left 983413069 4:167423019-167423041 CCCTCATATGGAGATTTAACTGA 0: 7
1: 5
2: 7
3: 12
4: 120
Right 983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983413074 Original CRISPR ACTGAAAGGCAGACTGGAGA GGG Intergenic
No off target data available for this crispr