ID: 983415201

View in Genome Browser
Species Human (GRCh38)
Location 4:167443488-167443510
Sequence TTCTGAGGTCCCTACTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983415197_983415201 -7 Left 983415197 4:167443472-167443494 CCATTGTCTTCCCTACTTCTGAG No data
Right 983415201 4:167443488-167443510 TTCTGAGGTCCCTACTTTTGAGG No data
983415196_983415201 12 Left 983415196 4:167443453-167443475 CCACAGACTGAAGGCTGCACCAT 0: 8
1: 80
2: 653
3: 724
4: 643
Right 983415201 4:167443488-167443510 TTCTGAGGTCCCTACTTTTGAGG No data
983415195_983415201 19 Left 983415195 4:167443446-167443468 CCTTTTGCCACAGACTGAAGGCT No data
Right 983415201 4:167443488-167443510 TTCTGAGGTCCCTACTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983415201 Original CRISPR TTCTGAGGTCCCTACTTTTG AGG Intergenic
No off target data available for this crispr