ID: 983420240

View in Genome Browser
Species Human (GRCh38)
Location 4:167507278-167507300
Sequence AGTCAGACCTGATCTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983420240_983420248 6 Left 983420240 4:167507278-167507300 CCCTGCAGAGATCAGGTCTGACT No data
Right 983420248 4:167507307-167507329 CTAGGGCTAAAGTCTTTTTTGGG No data
983420240_983420247 5 Left 983420240 4:167507278-167507300 CCCTGCAGAGATCAGGTCTGACT No data
Right 983420247 4:167507306-167507328 CCTAGGGCTAAAGTCTTTTTTGG No data
983420240_983420249 25 Left 983420240 4:167507278-167507300 CCCTGCAGAGATCAGGTCTGACT No data
Right 983420249 4:167507326-167507348 TGGGAGCAAATCTAGCCTAGAGG No data
983420240_983420250 26 Left 983420240 4:167507278-167507300 CCCTGCAGAGATCAGGTCTGACT No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983420240 Original CRISPR AGTCAGACCTGATCTCTGCA GGG (reversed) Intergenic