ID: 983420241

View in Genome Browser
Species Human (GRCh38)
Location 4:167507279-167507301
Sequence TAGTCAGACCTGATCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983420241_983420249 24 Left 983420241 4:167507279-167507301 CCTGCAGAGATCAGGTCTGACTA No data
Right 983420249 4:167507326-167507348 TGGGAGCAAATCTAGCCTAGAGG No data
983420241_983420247 4 Left 983420241 4:167507279-167507301 CCTGCAGAGATCAGGTCTGACTA No data
Right 983420247 4:167507306-167507328 CCTAGGGCTAAAGTCTTTTTTGG No data
983420241_983420250 25 Left 983420241 4:167507279-167507301 CCTGCAGAGATCAGGTCTGACTA No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data
983420241_983420248 5 Left 983420241 4:167507279-167507301 CCTGCAGAGATCAGGTCTGACTA No data
Right 983420248 4:167507307-167507329 CTAGGGCTAAAGTCTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983420241 Original CRISPR TAGTCAGACCTGATCTCTGC AGG (reversed) Intergenic