ID: 983420245

View in Genome Browser
Species Human (GRCh38)
Location 4:167507305-167507327
Sequence CAAAAAAGACTTTAGCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983420245_983420251 8 Left 983420245 4:167507305-167507327 CCCTAGGGCTAAAGTCTTTTTTG No data
Right 983420251 4:167507336-167507358 TCTAGCCTAGAGGGATAGCCTGG No data
983420245_983420249 -2 Left 983420245 4:167507305-167507327 CCCTAGGGCTAAAGTCTTTTTTG No data
Right 983420249 4:167507326-167507348 TGGGAGCAAATCTAGCCTAGAGG No data
983420245_983420250 -1 Left 983420245 4:167507305-167507327 CCCTAGGGCTAAAGTCTTTTTTG No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983420245 Original CRISPR CAAAAAAGACTTTAGCCCTA GGG (reversed) Intergenic