ID: 983420250

View in Genome Browser
Species Human (GRCh38)
Location 4:167507327-167507349
Sequence GGGAGCAAATCTAGCCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983420240_983420250 26 Left 983420240 4:167507278-167507300 CCCTGCAGAGATCAGGTCTGACT No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data
983420244_983420250 0 Left 983420244 4:167507304-167507326 CCCCTAGGGCTAAAGTCTTTTTT No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data
983420241_983420250 25 Left 983420241 4:167507279-167507301 CCTGCAGAGATCAGGTCTGACTA No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data
983420245_983420250 -1 Left 983420245 4:167507305-167507327 CCCTAGGGCTAAAGTCTTTTTTG No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data
983420246_983420250 -2 Left 983420246 4:167507306-167507328 CCTAGGGCTAAAGTCTTTTTTGG No data
Right 983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983420250 Original CRISPR GGGAGCAAATCTAGCCTAGA GGG Intergenic