ID: 983422555

View in Genome Browser
Species Human (GRCh38)
Location 4:167538535-167538557
Sequence TGTTATTTCATTCCTTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10128
Summary {0: 13, 1: 357, 2: 1042, 3: 2255, 4: 6461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983422555_983422557 5 Left 983422555 4:167538535-167538557 CCATAAAAAGGAATGAAATAACA 0: 13
1: 357
2: 1042
3: 2255
4: 6461
Right 983422557 4:167538563-167538585 TGCAATGATCTGGATGAGATTGG No data
983422555_983422556 -5 Left 983422555 4:167538535-167538557 CCATAAAAAGGAATGAAATAACA 0: 13
1: 357
2: 1042
3: 2255
4: 6461
Right 983422556 4:167538553-167538575 TAACAGCATTTGCAATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983422555 Original CRISPR TGTTATTTCATTCCTTTTTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr