ID: 983422557

View in Genome Browser
Species Human (GRCh38)
Location 4:167538563-167538585
Sequence TGCAATGATCTGGATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983422555_983422557 5 Left 983422555 4:167538535-167538557 CCATAAAAAGGAATGAAATAACA 0: 13
1: 357
2: 1042
3: 2255
4: 6461
Right 983422557 4:167538563-167538585 TGCAATGATCTGGATGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983422557 Original CRISPR TGCAATGATCTGGATGAGAT TGG Intergenic
No off target data available for this crispr