ID: 983424602

View in Genome Browser
Species Human (GRCh38)
Location 4:167567418-167567440
Sequence TTTCTTTGCGAGGACATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983424600_983424602 -2 Left 983424600 4:167567397-167567419 CCATACAAAGGAACAAGTTCATT No data
Right 983424602 4:167567418-167567440 TTTCTTTGCGAGGACATAGATGG No data
983424598_983424602 16 Left 983424598 4:167567379-167567401 CCACGGAATACTATGCAGCCATA 0: 665
1: 25364
2: 13870
3: 8001
4: 5187
Right 983424602 4:167567418-167567440 TTTCTTTGCGAGGACATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983424602 Original CRISPR TTTCTTTGCGAGGACATAGA TGG Intergenic
No off target data available for this crispr