ID: 983425214

View in Genome Browser
Species Human (GRCh38)
Location 4:167575143-167575165
Sequence GCTCAAAGGTTAGTTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983425214_983425223 1 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425223 4:167575167-167575189 AGATGGCCCTCTCATGGGGGAGG No data
983425214_983425221 -2 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425221 4:167575164-167575186 GCCAGATGGCCCTCTCATGGGGG No data
983425214_983425220 -3 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425220 4:167575163-167575185 AGCCAGATGGCCCTCTCATGGGG No data
983425214_983425219 -4 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425219 4:167575162-167575184 GAGCCAGATGGCCCTCTCATGGG No data
983425214_983425226 11 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425226 4:167575177-167575199 CTCATGGGGGAGGTCGACCTAGG No data
983425214_983425218 -5 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425218 4:167575161-167575183 TGAGCCAGATGGCCCTCTCATGG No data
983425214_983425228 28 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983425214 Original CRISPR GCTCAAAGGTTAGTTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr