ID: 983425215

View in Genome Browser
Species Human (GRCh38)
Location 4:167575146-167575168
Sequence CTGGCTCAAAGGTTAGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 25, 1: 23, 2: 14, 3: 17, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983425215_983425219 -7 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425219 4:167575162-167575184 GAGCCAGATGGCCCTCTCATGGG No data
983425215_983425223 -2 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425223 4:167575167-167575189 AGATGGCCCTCTCATGGGGGAGG No data
983425215_983425220 -6 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425220 4:167575163-167575185 AGCCAGATGGCCCTCTCATGGGG No data
983425215_983425228 25 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425215_983425218 -8 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425218 4:167575161-167575183 TGAGCCAGATGGCCCTCTCATGG No data
983425215_983425226 8 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425226 4:167575177-167575199 CTCATGGGGGAGGTCGACCTAGG No data
983425215_983425221 -5 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425221 4:167575164-167575186 GCCAGATGGCCCTCTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983425215 Original CRISPR CTGGCTCAAAGGTTAGTTAA AGG (reversed) Intergenic
901804199 1:11727371-11727393 CTGGGTCAAAGGTTACAGAAAGG + Intergenic
909341833 1:74541003-74541025 CAGGCTTAAAGGTTGGTAAAAGG - Intronic
911047673 1:93642083-93642105 CTGGCTCTAAGGCCAGATAAGGG + Intronic
911159059 1:94665488-94665510 CTAACTCAAAAGTTATTTAAAGG - Intergenic
911162758 1:94698052-94698074 CTGGCTCAAAGGTTAGTTAAAGG + Intergenic
916951022 1:169780442-169780464 CTTGCTCCAAAGTTAGTGAAAGG - Intronic
918031439 1:180816457-180816479 CTGGGTCATAGGTTAGTACAGGG - Intronic
919575040 1:199297510-199297532 CTGGCTCAAAGGAGAATTAAAGG - Intergenic
922377388 1:224982049-224982071 TTGTCTCAAAGGTTAGTTAATGG - Intronic
924701262 1:246455808-246455830 CTGCCTCCAAGTTTATTTAAAGG - Intronic
1066478916 10:35776308-35776330 CTGACTCAAAGTTAAGTGAAGGG - Intergenic
1076929248 10:133518688-133518710 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
1077756234 11:5030773-5030795 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
1080675996 11:34427685-34427707 CTTGCTCAAGGGTTACTTTAGGG + Intergenic
1080740333 11:35057960-35057982 CTGGCTCACAGGCTATTTCAGGG + Intergenic
1082961729 11:58924322-58924344 CTGGCTCAAAGATTAGTTAGTGG + Intronic
1082962188 11:58928891-58928913 CTGTCTCAAAGGTTACTTAATGG + Intronic
1083125386 11:60560226-60560248 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
1086072847 11:82818580-82818602 CTGGTTCAAAGGTTAGTTAATGG - Intergenic
1086349495 11:85931250-85931272 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
1090583812 11:128188321-128188343 CTGGCTCAAAGCTTAGGTAGAGG - Intergenic
1093608130 12:21119286-21119308 CTGGCTCAAAAGTTTTTTTAGGG + Intronic
1094020430 12:25907923-25907945 CTGCCTCAAAGGTTTTTTTATGG + Intergenic
1097513832 12:60577820-60577842 CCAGCTCAAAGGTTAATTAATGG - Intergenic
1103920794 12:124398241-124398263 CTGGCTCAAAGGAGAGAAAAGGG - Intronic
1108507868 13:51128954-51128976 CTAGCTCAAAGGTTAGTTAATGG - Intergenic
1108606814 13:52047578-52047600 CTGGCTCACAGTTTACTTTATGG + Intronic
1109275731 13:60301660-60301682 CTGGCTCAAGGGACAGGTAAAGG - Intergenic
1110940878 13:81346459-81346481 CTGCCTCAAATGTAAGTTAAAGG + Intergenic
1112975111 13:105308169-105308191 CAGGCTGAAAGGTTAGAAAAAGG - Intergenic
1115243845 14:31275063-31275085 CTGATTCAAAGCTTATTTAAAGG + Intergenic
1115417596 14:33154321-33154343 TAGGATCAAAGGTGAGTTAAGGG - Intronic
1115839581 14:37453334-37453356 CTGTATCAAAGGTTAGTTATGGG - Intronic
1117187687 14:53258009-53258031 CTAGTTCAAAGCTTATTTAAAGG - Intergenic
1117509479 14:56435095-56435117 CTAATTCAAAGGTTATTTAAAGG + Intergenic
1118557803 14:67045083-67045105 CTGGATCACAGGTGAGTCAAGGG - Intronic
1123141816 14:106087300-106087322 CTGGCTTAAAGGTTAGTTAATGG - Intergenic
1123781036 15:23628795-23628817 TTGGCTTAAAGATTAGTTAATGG - Intronic
1128712932 15:69885505-69885527 CTAGTTGAAAGGTTAGTTGAAGG + Intergenic
1128784738 15:70386401-70386423 CTGGTTTAAAGGTTAGTTGAAGG - Intergenic
1131992185 15:98103223-98103245 ATGGTTCAAAGGTGAGCTAAAGG - Intergenic
1132098484 15:99005777-99005799 ATGGTTCAAAGGTGAGCTAAGGG + Intronic
1132150802 15:99456962-99456984 CTGGCTCAGAGCTGAGTGAATGG + Intergenic
1133821523 16:9241358-9241380 CAGGAGCAAAGGCTAGTTAAGGG - Intergenic
1134595317 16:15491255-15491277 CTGCCTCAAAGAATTGTTAAAGG - Intronic
1134778015 16:16869896-16869918 CTGGGTAAAAGGTGATTTAAAGG + Intergenic
1134862388 16:17572212-17572234 CTGGCTAAAAGATGAATTAAAGG + Intergenic
1137073731 16:35935148-35935170 CTGGCTGAAAGGTTAGTTAATGG + Intergenic
1139153309 16:64410951-64410973 CTGGCTCAAATGTATGTTAATGG + Intergenic
1139877453 16:70157528-70157550 CTGGCCCAAAGGTCTGCTAATGG - Exonic
1140527227 16:75632988-75633010 CTGGCTGAAAGGTTAGTTAATGG - Intronic
1141108451 16:81252655-81252677 CTGGCTCAAAGGGGAGATCAGGG + Intronic
1145215955 17:21052579-21052601 CTGGATCACAGGTAAGTTACTGG - Intergenic
1145876877 17:28325637-28325659 CTTCCTCAAAGGTTGGTAAATGG + Exonic
1148867533 17:50636569-50636591 CTGGCCCAAAGGGCAGTGAAAGG - Intronic
1149588913 17:57813060-57813082 ATGGCTCCAAGGTTATTTATGGG + Intergenic
1159323893 18:66891123-66891145 TTTACTCAAAGGTTATTTAAAGG - Intergenic
1162358301 19:10201107-10201129 CTGGCTCTAAGGTGGGTTAGGGG - Intronic
1167279135 19:48556374-48556396 CCGGCTCAGAGGTTGCTTAATGG - Intronic
1167905693 19:52658767-52658789 CTGGCTCAAAGGTTAGTTAATGG - Intronic
932091873 2:68813042-68813064 CTACCTCAAAGGTAAGTTCAAGG - Intronic
932524593 2:72450797-72450819 CTAGCTCTAATGTTAGTTTATGG - Intronic
937734095 2:125268712-125268734 CTTGATCAAAGTTTAGATAATGG + Intergenic
941526125 2:166609331-166609353 CAGGCTGAAAGGTTAGTTAATGG - Intergenic
941526669 2:166614683-166614705 CTAGCTCAAAGGATAGTTAATGG - Intergenic
941541046 2:166784681-166784703 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
942343914 2:174981408-174981430 CTGTCTCAAAAATTTGTTAAAGG - Intronic
947218961 2:227774492-227774514 CTGGCTCAACAGTTGGTTAACGG + Intergenic
947294409 2:228614938-228614960 CAGGCACCAAGGTTAGTTAGAGG - Intergenic
947402873 2:229746247-229746269 CTGTCTCATAGTTTAGTTTAGGG - Intergenic
1169227656 20:3866247-3866269 CTGGGTCAGAGGGGAGTTAAGGG + Exonic
1171506535 20:25640193-25640215 CTAACTCAAAGCTTATTTAAAGG - Intergenic
1175453346 20:59089655-59089677 CTGGCTCAGAGGGCATTTAAAGG + Intergenic
1177725777 21:24965716-24965738 CTTTCTCAAAGATTAGTTAATGG - Intergenic
1178672025 21:34599981-34600003 CTGGCTAGAAGGGTAGATAAGGG + Intronic
1181181946 22:21074655-21074677 ATGGCTCAAAGTTATGTTAAGGG - Intergenic
1181367216 22:22387283-22387305 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
1181419346 22:22786935-22786957 CTGGCTCAAAGGCTAGTTAATGG + Intronic
1184763440 22:46558546-46558568 CTGGTTCAAAGGGTTGTTAGAGG - Intergenic
951267775 3:20589484-20589506 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
953101788 3:39836916-39836938 CTGGCTCAAAAGTTAGTTAATGG + Intronic
955164382 3:56496508-56496530 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
958468066 3:94482890-94482912 ATGGCTCAAAGGCCAGTGAAAGG + Intergenic
958531785 3:95341620-95341642 CTAGCTTAAAGGTTAGTTAATGG + Intergenic
958585242 3:96078658-96078680 CTCGCTCAAAAATTAGTTAAAGG + Intergenic
958748445 3:98165416-98165438 CTAACTCAAAGGTTAGTTAATGG + Intergenic
959329381 3:104983613-104983635 GAGGCTCCAAGGTGAGTTAATGG - Intergenic
959333840 3:105039512-105039534 CTGGATCAAAGGTGGGTTAGAGG + Intergenic
963956132 3:151255970-151255992 CTAGCTCTAAGGTCAGTAAATGG + Intronic
966021534 3:175217724-175217746 TTGGTTCAATGGTTAGCTAAAGG - Intronic
966508072 3:180729545-180729567 CTGGTTCATTGGTTAGTTTAGGG - Intronic
971920359 4:32931631-32931653 CTGCCTCACAGGTTTGTTTAAGG + Intergenic
972083991 4:35190493-35190515 CTGGCTCAAAGGTTAGTCAGTGG - Intergenic
974570570 4:63642034-63642056 CTGGCTAAGAGATTAGTCAAAGG - Intergenic
975044057 4:69781900-69781922 CTGGCTCAAAGGTTAGTTAATGG - Intronic
975105483 4:70564118-70564140 CTGGCTCAAAGGCTAGTTAATGG - Intergenic
976071627 4:81247093-81247115 CTGTCTCAAAAGTTATTTTATGG - Intergenic
976861872 4:89675259-89675281 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
977026296 4:91822706-91822728 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
977657344 4:99537045-99537067 CTGGGTCAAAGGTTAGTTAATGG - Intronic
978406074 4:108380113-108380135 CTTGCCCAAAGGTCAGTGAAAGG + Intergenic
979160533 4:117454646-117454668 CTGTCTCAAAAGTTTGTTAGAGG - Intergenic
979405289 4:120303331-120303353 TTTGCTCAAAGGATAGATAAAGG + Intergenic
979744103 4:124188306-124188328 CTTACTCAAAGGTTTGTTCAGGG - Intergenic
980608311 4:135122653-135122675 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
981141954 4:141279004-141279026 CTGGCTTAAAGGTTAGTTAATGG + Intergenic
983425215 4:167575146-167575168 CTGGCTCAAAGGTTAGTTAAAGG - Intergenic
984402531 4:179285810-179285832 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
984719361 4:182955578-182955600 CTGGCTCAAAGATGAGTCAGTGG + Intergenic
985080673 4:186261081-186261103 CTGGCTCCAAGGTCAGCCAAGGG + Intergenic
985227140 4:187773985-187774007 CTAACTCAAAGCTTATTTAAAGG - Intergenic
985296055 4:188438521-188438543 CTGGCTCAAAGGTTAGTTATTGG - Intergenic
987639584 5:20595440-20595462 CTGACTTAAAGGTTAGTTAATGG - Intergenic
988132350 5:27121164-27121186 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
990404117 5:55470723-55470745 ATGGCTCAAAGGTTAGGGTAAGG - Intronic
992293461 5:75304252-75304274 CTAATTCAAAGGTTATTTAAAGG + Intergenic
994756074 5:103795006-103795028 CTAGCTTAAAGTTTATTTAAAGG + Intergenic
996411288 5:123162112-123162134 CTGGCTCAGAGCTTAGTAAGTGG - Intronic
996852519 5:127968253-127968275 CTGGGTCTAAGATTAATTAATGG + Intergenic
998412481 5:141922305-141922327 ATGGCTCAAAAGTTCTTTAACGG + Intergenic
998927299 5:147140780-147140802 CTGTCTCAAAGGTTAGTTAATGG - Intergenic
1000861943 5:166466539-166466561 CAGGCTGAAAGGTAAGATAAAGG - Intergenic
1001097857 5:168789662-168789684 ATGGCTCAAAGGTGCGATAACGG + Intronic
1002995169 6:2276079-2276101 CTGGATGAAAGGTTAATTAAAGG + Intergenic
1005014112 6:21361205-21361227 CTGGCTAAAAGGGGAGTGAAAGG - Intergenic
1007444092 6:41891076-41891098 CTGGATAAAAGGTTAGTAACAGG + Intronic
1008882918 6:56399778-56399800 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
1009736743 6:67686140-67686162 CTAGTTCAAAGGTTATTTAGAGG + Intergenic
1011122890 6:83973938-83973960 CTACTTCAAAGGTTATTTAAAGG - Intergenic
1013893428 6:115054402-115054424 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
1018880115 6:167869452-167869474 CTGGCTCAAAGAACAGTTGAAGG + Intronic
1020214293 7:6177811-6177833 CTGGGTGAAAGGTGAGTTAGAGG - Exonic
1022036264 7:26537645-26537667 CTGCCTCAAAGGGTCATTAAGGG + Intronic
1022276465 7:28860083-28860105 CTGTCTCAGTGGTTAGGTAATGG + Intergenic
1022418260 7:30196848-30196870 CTAATTCAAAGGTTATTTAAAGG - Intergenic
1023568107 7:41543624-41543646 CTGCCTCAAAGGTAAATAAATGG - Intergenic
1025010600 7:55394603-55394625 CTGTCTCAAAGTTTTGCTAAAGG - Intronic
1027703712 7:81501704-81501726 ATTGCTTAAAGGTTAGTTGAAGG + Intergenic
1028023165 7:85804058-85804080 CTTGCATTAAGGTTAGTTAAGGG + Intergenic
1030354618 7:108528194-108528216 CTGGGTCAGAGGTTAGTTACAGG - Intronic
1031227450 7:119058260-119058282 CTAACTCAAAGCTTATTTAAAGG - Intergenic
1034762893 7:153690093-153690115 CTGGCTCAAAGATTAGTTAATGG - Intergenic
1035434149 7:158845936-158845958 CTACTTCAAAGGTTATTTAAAGG + Intergenic
1035632976 8:1122090-1122112 CTGGCTCAAAGTTCACCTAAGGG - Intergenic
1039906337 8:41789209-41789231 CTGAGTCAAAGGTGCGTTAAAGG + Intronic
1041297171 8:56369500-56369522 CAGCCTCAAAGCTTATTTAAGGG - Intergenic
1041359453 8:57036674-57036696 CTGGCTCAAAGGTTGGTTAATGG + Intergenic
1041558766 8:59190458-59190480 GTGGCTCAAAGATTACTCAAAGG + Intergenic
1044528894 8:93285354-93285376 CTGGCTCAAAGGTGAATTTGAGG + Intergenic
1044536157 8:93358450-93358472 CTGCCTCAAAGGATTGTAAAGGG - Intergenic
1045709428 8:104965614-104965636 CTGGCTCCATGGTTTGGTAATGG + Intronic
1047570454 8:126093412-126093434 TTGGATTAAAGGATAGTTAATGG + Intergenic
1048121097 8:131582684-131582706 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
1049153022 8:141047877-141047899 CTGGCACAAAGGCCAGTTTATGG + Intergenic
1051232615 9:14968111-14968133 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
1054979193 9:71184235-71184257 CTGGATCAAAGGATAACTAATGG + Intronic
1059704333 9:116806339-116806361 CTGTCTCAAAGGCTTGTCAAGGG - Intronic
1187157133 X:16731115-16731137 CTAACTCAAAGCTTATTTAAAGG - Intronic
1188939141 X:36215843-36215865 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
1189079875 X:37959540-37959562 CTGGCTCAAAGGTTAGTTATTGG + Intronic
1190947691 X:55111784-55111806 CTGGCTCAAAGGTTAGTTAATGG - Intronic
1193596602 X:83453373-83453395 CTAGCTCAAAGGTTTGCTGAAGG + Intergenic
1193840389 X:86401671-86401693 CTGGCTAACAGGTAAGTGAAAGG + Intronic
1194032937 X:88837905-88837927 CTGGCTCAAAGGTTAGTTAATGG + Intergenic
1196968550 X:121084437-121084459 CTGGCTCAAAGGTTAGTTAATGG - Intergenic
1197329329 X:125134135-125134157 TTGTCTCAAAGGTAAGATAAAGG + Intergenic
1198484493 X:137073367-137073389 CTTGCTCAAAGGTTAGCCATAGG + Intergenic
1200285443 X:154817799-154817821 CTAATTCAAAGGTTATTTAAAGG - Intronic
1200745473 Y:6900237-6900259 CTGGCTCAATGGTTAGTTAATGG - Intergenic
1200823853 Y:7619027-7619049 TTGGTACAAAGGTTAGTTAATGG + Intergenic
1201055105 Y:9980794-9980816 CTGGCTCAAAAGTTAGTTGATGG - Intergenic
1201575143 Y:15455260-15455282 CTGGCTCAAAGGTTAATTAATGG - Intergenic
1201618318 Y:15926624-15926646 GTGGCTCAAAGCTTAGTTAATGG - Intergenic
1201628544 Y:16042507-16042529 CTGGCTCAAAGTTTAGTTAATGG + Intergenic
1201647915 Y:16255758-16255780 CTGGCTTAAAGGTTAGTTAATGG - Intergenic
1201654895 Y:16329543-16329565 CTGGCTTAAAGGTTAGTTAATGG + Intergenic
1201856771 Y:18553147-18553169 CTGCCTTAAAGGTTAGTTAATGG - Intronic
1201876550 Y:18767233-18767255 CTGCCTTAAAGGTTAGTTAATGG + Intronic
1202191278 Y:22248633-22248655 CTGGCTAAAAAGTTAGTTAATGG + Intergenic
1202236203 Y:22712061-22712083 TTGGTACAAAGGTTAGTTAATGG - Intergenic
1202258843 Y:22948445-22948467 CTGGCTTAAAGGTTAGTTAATGG - Intergenic
1202261591 Y:22975952-22975974 CTGGTTCAAAGACTGGTTAATGG - Intronic
1202306962 Y:23484107-23484129 TTGGTACAAAGGTTAGTTAATGG + Intergenic
1202411831 Y:24582203-24582225 CTGGCTTAAAGGTTAGTTAATGG - Intergenic
1202414579 Y:24609693-24609715 CTGGTTCAAAGACTGGTTAATGG - Intronic
1202456206 Y:25060393-25060415 CTGGTTCAAAGACTGGTTAATGG + Intronic
1202458951 Y:25087869-25087891 CTGGCTTAAAGGTTAGTTAATGG + Intergenic
1202563845 Y:26186479-26186501 TTGGTACAAAGGTTAGTTAATGG - Intergenic