ID: 983425217

View in Genome Browser
Species Human (GRCh38)
Location 4:167575157-167575179
Sequence GAGAGGGCCATCTGGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983425217_983425226 -3 Left 983425217 4:167575157-167575179 CCTTTGAGCCAGATGGCCCTCTC No data
Right 983425226 4:167575177-167575199 CTCATGGGGGAGGTCGACCTAGG No data
983425217_983425228 14 Left 983425217 4:167575157-167575179 CCTTTGAGCCAGATGGCCCTCTC No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983425217 Original CRISPR GAGAGGGCCATCTGGCTCAA AGG (reversed) Intergenic
No off target data available for this crispr