ID: 983425222

View in Genome Browser
Species Human (GRCh38)
Location 4:167575165-167575187
Sequence TCCCCCATGAGAGGGCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983425222_983425228 6 Left 983425222 4:167575165-167575187 CCAGATGGCCCTCTCATGGGGGA No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425222_983425233 25 Left 983425222 4:167575165-167575187 CCAGATGGCCCTCTCATGGGGGA No data
Right 983425233 4:167575213-167575235 AAGGCTTTTACTTTAAACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983425222 Original CRISPR TCCCCCATGAGAGGGCCATC TGG (reversed) Intergenic
No off target data available for this crispr