ID: 983425224

View in Genome Browser
Species Human (GRCh38)
Location 4:167575173-167575195
Sequence GGTCGACCTCCCCCATGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983425224_983425228 -2 Left 983425224 4:167575173-167575195 CCCTCTCATGGGGGAGGTCGACC No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425224_983425233 17 Left 983425224 4:167575173-167575195 CCCTCTCATGGGGGAGGTCGACC No data
Right 983425233 4:167575213-167575235 AAGGCTTTTACTTTAAACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983425224 Original CRISPR GGTCGACCTCCCCCATGAGA GGG (reversed) Intergenic
No off target data available for this crispr