ID: 983425225

View in Genome Browser
Species Human (GRCh38)
Location 4:167575174-167575196
Sequence AGGTCGACCTCCCCCATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983425225_983425233 16 Left 983425225 4:167575174-167575196 CCTCTCATGGGGGAGGTCGACCT No data
Right 983425233 4:167575213-167575235 AAGGCTTTTACTTTAAACCGTGG No data
983425225_983425228 -3 Left 983425225 4:167575174-167575196 CCTCTCATGGGGGAGGTCGACCT No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983425225 Original CRISPR AGGTCGACCTCCCCCATGAG AGG (reversed) Intergenic
No off target data available for this crispr