ID: 983425228

View in Genome Browser
Species Human (GRCh38)
Location 4:167575194-167575216
Sequence CCTAGGATATTGCCCCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983425215_983425228 25 Left 983425215 4:167575146-167575168 CCTTTAACTAACCTTTGAGCCAG 0: 25
1: 23
2: 14
3: 17
4: 109
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425217_983425228 14 Left 983425217 4:167575157-167575179 CCTTTGAGCCAGATGGCCCTCTC No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425224_983425228 -2 Left 983425224 4:167575173-167575195 CCCTCTCATGGGGGAGGTCGACC No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425214_983425228 28 Left 983425214 4:167575143-167575165 CCTCCTTTAACTAACCTTTGAGC No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425225_983425228 -3 Left 983425225 4:167575174-167575196 CCTCTCATGGGGGAGGTCGACCT No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data
983425222_983425228 6 Left 983425222 4:167575165-167575187 CCAGATGGCCCTCTCATGGGGGA No data
Right 983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983425228 Original CRISPR CCTAGGATATTGCCCCCTAA AGG Intergenic
No off target data available for this crispr