ID: 983436763

View in Genome Browser
Species Human (GRCh38)
Location 4:167725147-167725169
Sequence GCCCCCACTTCTGGCACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983436759_983436763 12 Left 983436759 4:167725112-167725134 CCAAGCTGCTTCATTACAGCAGG No data
Right 983436763 4:167725147-167725169 GCCCCCACTTCTGGCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983436763 Original CRISPR GCCCCCACTTCTGGCACTCA GGG Intergenic
No off target data available for this crispr