ID: 983438238

View in Genome Browser
Species Human (GRCh38)
Location 4:167745175-167745197
Sequence CAGAAATAGATCAACTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983438230_983438238 26 Left 983438230 4:167745126-167745148 CCTCTCTAAGGCCAGAAGCCAAA No data
Right 983438238 4:167745175-167745197 CAGAAATAGATCAACTTGACAGG No data
983438233_983438238 15 Left 983438233 4:167745137-167745159 CCAGAAGCCAAAAGAGGGTTTGA No data
Right 983438238 4:167745175-167745197 CAGAAATAGATCAACTTGACAGG No data
983438236_983438238 8 Left 983438236 4:167745144-167745166 CCAAAAGAGGGTTTGAAAGGGAA No data
Right 983438238 4:167745175-167745197 CAGAAATAGATCAACTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983438238 Original CRISPR CAGAAATAGATCAACTTGAC AGG Intergenic
No off target data available for this crispr