ID: 983447853

View in Genome Browser
Species Human (GRCh38)
Location 4:167877227-167877249
Sequence GCAAGTCCCGCTTTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983447846_983447853 -1 Left 983447846 4:167877205-167877227 CCCTTCTCCTTCACCCTTAGTGG 0: 143
1: 304
2: 349
3: 426
4: 493
Right 983447853 4:167877227-167877249 GCAAGTCCCGCTTTTCTTGGAGG No data
983447848_983447853 -2 Left 983447848 4:167877206-167877228 CCTTCTCCTTCACCCTTAGTGGC 0: 148
1: 295
2: 218
3: 88
4: 242
Right 983447853 4:167877227-167877249 GCAAGTCCCGCTTTTCTTGGAGG No data
983447845_983447853 0 Left 983447845 4:167877204-167877226 CCCCTTCTCCTTCACCCTTAGTG 0: 147
1: 289
2: 224
3: 98
4: 363
Right 983447853 4:167877227-167877249 GCAAGTCCCGCTTTTCTTGGAGG No data
983447849_983447853 -8 Left 983447849 4:167877212-167877234 CCTTCACCCTTAGTGGCAAGTCC 0: 212
1: 594
2: 424
3: 169
4: 131
Right 983447853 4:167877227-167877249 GCAAGTCCCGCTTTTCTTGGAGG No data
983447844_983447853 4 Left 983447844 4:167877200-167877222 CCAACCCCTTCTCCTTCACCCTT 0: 93
1: 75
2: 30
3: 120
4: 1220
Right 983447853 4:167877227-167877249 GCAAGTCCCGCTTTTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983447853 Original CRISPR GCAAGTCCCGCTTTTCTTGG AGG Intergenic
No off target data available for this crispr