ID: 983452893

View in Genome Browser
Species Human (GRCh38)
Location 4:167929277-167929299
Sequence GAGGGTGTCAAGGGCGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983452889_983452893 -7 Left 983452889 4:167929261-167929283 CCTAGATTGCCATAAAGAGGGTG No data
Right 983452893 4:167929277-167929299 GAGGGTGTCAAGGGCGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983452893 Original CRISPR GAGGGTGTCAAGGGCGATTC TGG Intergenic
No off target data available for this crispr