ID: 983453430

View in Genome Browser
Species Human (GRCh38)
Location 4:167934038-167934060
Sequence TGATGCAATTACAGTTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983453425_983453430 25 Left 983453425 4:167933990-167934012 CCAAAAATAGCCCAAAACCTAGT No data
Right 983453430 4:167934038-167934060 TGATGCAATTACAGTTTACTTGG No data
983453429_983453430 -9 Left 983453429 4:167934024-167934046 CCATGTATTATTGTTGATGCAAT No data
Right 983453430 4:167934038-167934060 TGATGCAATTACAGTTTACTTGG No data
983453428_983453430 8 Left 983453428 4:167934007-167934029 CCTAGTTAAAAAATCTACCATGT No data
Right 983453430 4:167934038-167934060 TGATGCAATTACAGTTTACTTGG No data
983453427_983453430 14 Left 983453427 4:167934001-167934023 CCAAAACCTAGTTAAAAAATCTA No data
Right 983453430 4:167934038-167934060 TGATGCAATTACAGTTTACTTGG No data
983453426_983453430 15 Left 983453426 4:167934000-167934022 CCCAAAACCTAGTTAAAAAATCT No data
Right 983453430 4:167934038-167934060 TGATGCAATTACAGTTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983453430 Original CRISPR TGATGCAATTACAGTTTACT TGG Intergenic
No off target data available for this crispr