ID: 983460043

View in Genome Browser
Species Human (GRCh38)
Location 4:168016096-168016118
Sequence GCCCTAAGAATGCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983460043_983460047 2 Left 983460043 4:168016096-168016118 CCTTGCTCCAGCATTCTTAGGGC No data
Right 983460047 4:168016121-168016143 GGGCAATAATTCCCCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983460043 Original CRISPR GCCCTAAGAATGCTGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr