ID: 983469753

View in Genome Browser
Species Human (GRCh38)
Location 4:168141920-168141942
Sequence AGTGCGCATGCGTGGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 80}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983469746_983469753 -5 Left 983469746 4:168141902-168141924 CCTCCCTTACTATTAGTCAGTGC 0: 1
1: 0
2: 2
3: 12
4: 72
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469744_983469753 10 Left 983469744 4:168141887-168141909 CCAGGTTTGTGGGGCCCTCCCTT 0: 1
1: 2
2: 13
3: 27
4: 179
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469747_983469753 -8 Left 983469747 4:168141905-168141927 CCCTTACTATTAGTCAGTGCGCA 0: 1
1: 0
2: 2
3: 3
4: 46
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469736_983469753 27 Left 983469736 4:168141870-168141892 CCTGCCTAGTTTCCACCCCAGGT 0: 1
1: 1
2: 5
3: 19
4: 187
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469734_983469753 28 Left 983469734 4:168141869-168141891 CCCTGCCTAGTTTCCACCCCAGG 0: 1
1: 5
2: 3
3: 33
4: 216
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469743_983469753 11 Left 983469743 4:168141886-168141908 CCCAGGTTTGTGGGGCCCTCCCT 0: 1
1: 2
2: 12
3: 26
4: 176
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469737_983469753 23 Left 983469737 4:168141874-168141896 CCTAGTTTCCACCCCAGGTTTGT 0: 1
1: 3
2: 10
3: 32
4: 199
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469748_983469753 -9 Left 983469748 4:168141906-168141928 CCTTACTATTAGTCAGTGCGCAT 0: 1
1: 0
2: 1
3: 8
4: 33
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469741_983469753 15 Left 983469741 4:168141882-168141904 CCACCCCAGGTTTGTGGGGCCCT 0: 1
1: 1
2: 6
3: 25
4: 200
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469745_983469753 -4 Left 983469745 4:168141901-168141923 CCCTCCCTTACTATTAGTCAGTG 0: 1
1: 0
2: 2
3: 15
4: 132
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80
983469742_983469753 12 Left 983469742 4:168141885-168141907 CCCCAGGTTTGTGGGGCCCTCCC 0: 1
1: 1
2: 6
3: 19
4: 202
Right 983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983469753 Original CRISPR AGTGCGCATGCGTGGGCCAG GGG Intronic
900123253 1:1058570-1058592 AGTGGGGCTGCGTGGGCCTGGGG + Intergenic
903132679 1:21290012-21290034 AGCGCGCATGCCCGGGCCCGGGG + Intronic
903492895 1:23743272-23743294 AGCGCGCACACTTGGGCCAGGGG + Exonic
907195000 1:52679327-52679349 AGGGGGCATGCCTGGGGCAGGGG - Intergenic
911114725 1:94235878-94235900 AGGGGGCATGCGTGGGGCAGCGG - Intronic
912246511 1:107965882-107965904 ACTGCGCATGCGTCGGCGACTGG + Intergenic
912387932 1:109281826-109281848 AGAGCGCAGGCGAGGGCCTGGGG - Exonic
919445644 1:197701418-197701440 AGGGCCCATTCGGGGGCCAGGGG + Intronic
922054608 1:222028776-222028798 ACTGCAAATGCGTGGGCCACAGG + Intergenic
1064967184 10:21026933-21026955 AGTGCCCATGGGTGGCCAAGAGG - Intronic
1068370103 10:56102321-56102343 AGTGCGCATGCGTGCACCTTTGG - Intergenic
1077178315 11:1200569-1200591 AGTGCGGCTGCATGGGCCGGCGG + Intronic
1081701859 11:45157499-45157521 AGTACCCATCCGTGGTCCAGGGG + Intronic
1084326642 11:68404119-68404141 GGTGCACATGCGTGGGCCACAGG - Intronic
1085282341 11:75339562-75339584 AGTGCGTTTGTGTGAGCCAGAGG - Intronic
1092488936 12:8927136-8927158 TGCGCGCATGCGTGGGCAGGGGG + Intronic
1093755838 12:22850913-22850935 AGTGGGCAGGGGTGGGCCACAGG + Intergenic
1094840505 12:34340851-34340873 AGTGGGCATGGGTGTGCAAGAGG - Intergenic
1094846007 12:34361719-34361741 AGAGCGCATGCGTGGGGCCATGG - Intergenic
1101466988 12:104958574-104958596 AGTGGGCGTGCGTGGGCTGGTGG - Intronic
1101564235 12:105890522-105890544 AGTTCGCATGGGTGTGTCAGGGG - Intergenic
1105559313 13:21475501-21475523 AGTGTGCGTGTGTGGGGCAGGGG + Intergenic
1107447785 13:40483785-40483807 ACTGCACATGCGTCTGCCAGTGG - Intergenic
1115706631 14:36005903-36005925 AGTGCGCATGTCTGGGAGAGGGG + Intergenic
1121638003 14:95466656-95466678 AGTGGGTGTGCGTGTGCCAGCGG - Intronic
1122160636 14:99781586-99781608 AGTGCACATACCTGGGCCAGGGG - Intronic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1124650233 15:31469016-31469038 GGTGGCCATGGGTGGGCCAGAGG + Intergenic
1132691005 16:1181946-1181968 AGGGGGCATGCGTGTGCGAGGGG - Intronic
1132691009 16:1181964-1181986 TGTGTGCATGCGTGTGCGAGGGG - Intronic
1132889675 16:2197357-2197379 AGTGGGCAGACGTGGGCCGGGGG - Intergenic
1133542807 16:6772791-6772813 TGTGCGTATGTGTGGGCCTGGGG + Intronic
1135574697 16:23576546-23576568 AGTGCGCATCCCAGGGGCAGAGG + Intergenic
1141781858 16:86167898-86167920 AGTGTGCCTGGGTGGCCCAGGGG + Intergenic
1143024045 17:3930515-3930537 TGTGCCCAGGCGTGGGCCAAGGG - Intronic
1144668884 17:17120309-17120331 AGTGCTTCTGCTTGGGCCAGGGG + Intronic
1146359101 17:32159655-32159677 TGTGCGCATGCTTGGGACAGTGG + Intronic
1152739038 17:82011127-82011149 ACTGGGCATGGGTGGGGCAGAGG + Intronic
1153716925 18:7859560-7859582 AGTGGGCATACTTGGGCCAGAGG - Intronic
1157032437 18:43928785-43928807 AGTGCTCATGGGTGGCTCAGTGG - Intergenic
1159754785 18:72351013-72351035 AGTGAGCCTGTGTGGTCCAGGGG - Intergenic
1160539269 18:79611542-79611564 AGTGCCCATCCCTGGGCCTGTGG - Intergenic
1161704427 19:5812504-5812526 ACTGCGTCTGCGGGGGCCAGAGG - Intergenic
1161781747 19:6297650-6297672 TGTGCACATGCTTGGGGCAGTGG + Intergenic
1165864803 19:38930444-38930466 AGTGCGCCTGCGCCGGCCGGGGG - Intronic
1166878220 19:45911221-45911243 AGTGGGCATGCAGGGGCCACTGG - Intergenic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167430809 19:49453398-49453420 AGTGCGCATGCGTGGCTCTCCGG - Exonic
1167590629 19:50402588-50402610 TGTGGGCATGGGTGGGTCAGCGG - Intronic
929453487 2:42051238-42051260 AGTGTGTATGCGTGTGTCAGGGG - Intronic
929720371 2:44361878-44361900 AGCGCGCATGCCTGGTCCGGTGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
935111608 2:100099343-100099365 AGGGGGCATGCGCAGGCCAGTGG - Intronic
942090222 2:172482871-172482893 TGTGCGCATGTGTGTGCAAGTGG + Intronic
946527355 2:220535051-220535073 AGTTCTCTTGCATGGGCCAGTGG + Intergenic
948578788 2:238970513-238970535 AGTGGGCATGCATGGGGCTGGGG - Intergenic
1171079152 20:22160450-22160472 ACTGCGCAGGCGTGGGGCAGGGG + Intergenic
1175751452 20:61500877-61500899 AGAGCGGCTGCGTGGGCCTGAGG - Intronic
1181015368 22:20065686-20065708 AGTGCCCTTGAGTGTGCCAGAGG + Exonic
1181871779 22:25905151-25905173 AGTGGGGATGGGTGGGACAGGGG + Intronic
1182064436 22:27420597-27420619 AGTGGGCATGGGTGGGAAAGTGG - Intergenic
1184694096 22:46130284-46130306 AGGGAGCATGCATGGGCCATGGG + Intergenic
952160535 3:30689019-30689041 AGTGAGCACGCGTGGGAAAGAGG + Intronic
965793144 3:172411137-172411159 TGGGCGCATGCTTGGGGCAGTGG - Intergenic
969226243 4:5800444-5800466 AGTGCAAATGTGTGTGCCAGTGG + Intronic
970406878 4:15772573-15772595 AGTGTGCATTCCTGGGCTAGGGG + Intergenic
975118801 4:70706002-70706024 AGAGCGCTCGCGTGTGCCAGTGG - Intronic
983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG + Intronic
990745013 5:58950440-58950462 AGTGCCCATGCAGGGGCCTGGGG + Intergenic
993015063 5:82526084-82526106 AGTGCACATGAGTTGCCCAGAGG + Intergenic
1001972588 5:175968274-175968296 CGGGCGCATGCGTGCGGCAGCGG - Exonic
1002244853 5:177875507-177875529 CGGGCGCATGCGTGCGGCAGCGG + Intergenic
1002432759 5:179212733-179212755 AGTGGGCAGGTGTGGGCCTGAGG + Intronic
1003038341 6:2664454-2664476 AGTGTGCATGCGTGTGCTGGGGG - Exonic
1003840379 6:10113389-10113411 GGTGCGCAGGCCTGGCCCAGCGG + Intronic
1006169705 6:32085900-32085922 ACTGCGCATGCGGGTGCCCGAGG - Intronic
1012991706 6:105933000-105933022 AAAGCGCATTCGTGTGCCAGTGG + Intergenic
1017656538 6:156634478-156634500 AGTGCGCAAGCGTGGGCTAATGG - Intergenic
1018400113 6:163413932-163413954 AGCGCGCCTGCGTGGGGCGGGGG - Intergenic
1025187804 7:56874627-56874649 AGTGCGCATACATGGGCCAGCGG + Intergenic
1025684118 7:63702299-63702321 AGTGCGCATACATGGGCCAGCGG - Intergenic
1029142757 7:98423341-98423363 AGTTCTCATGCCTGGGGCAGAGG - Intergenic
1029413504 7:100429697-100429719 AGTGCGCATGCGTGGTTCCCGGG + Exonic
1035175310 7:157045919-157045941 TGTGTGCATGCGTGGGGCATGGG - Intergenic
1037839593 8:22234232-22234254 ATTGCTCATGCTTGGGCCACAGG - Intergenic
1042059098 8:64798430-64798452 AGGGCGCATGCGTGGCCTGGCGG + Intronic
1049472424 8:142782439-142782461 AGTGGGGATGGGTGGGCCTGCGG + Intergenic
1053003416 9:34590033-34590055 AGTGCGGACGAGTGTGCCAGCGG - Intronic
1057222238 9:93263668-93263690 AGCGCGCACGCGTGGACCTGCGG - Exonic
1061180425 9:129022256-129022278 AGTGCGTGTTCGTGGGCCCGGGG - Intronic