ID: 983472150

View in Genome Browser
Species Human (GRCh38)
Location 4:168170509-168170531
Sequence TCTTCTCCAAACCATGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983472149_983472150 -6 Left 983472149 4:168170492-168170514 CCTAATAGGCATAAAGGTCTTCT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 983472150 4:168170509-168170531 TCTTCTCCAAACCATGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983472150 Original CRISPR TCTTCTCCAAACCATGATTC AGG Intronic
No off target data available for this crispr