ID: 983490802

View in Genome Browser
Species Human (GRCh38)
Location 4:168386773-168386795
Sequence CTGCTGTCATTGTTTCGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983490802_983490804 15 Left 983490802 4:168386773-168386795 CCCATGCGAAACAATGACAGCAG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 983490804 4:168386811-168386833 GAAGACAGAGATTAGAAAGATGG 0: 1
1: 1
2: 31
3: 282
4: 1828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983490802 Original CRISPR CTGCTGTCATTGTTTCGCAT GGG (reversed) Intronic
905035391 1:34914915-34914937 CTGCTGTCTTTGGTACGCTTAGG - Intronic
908809976 1:67971070-67971092 CTGCTTTCACTGTATCCCATAGG + Intergenic
909454851 1:75838716-75838738 CTGCTGTCATTTTCTGGCTTTGG + Intronic
910785653 1:90995610-90995632 CTGCTGTCAAGGTTTCTCTTTGG - Intronic
912316769 1:108674514-108674536 CTGCTTTCACTGTATCCCATAGG - Intergenic
915178339 1:154036053-154036075 CTGCTTTCACTGTATCTCATAGG + Intronic
915186452 1:154109880-154109902 CTGCTTTCACTGTATCTCATAGG - Intronic
915855509 1:159381802-159381824 CTGCTGTCTTTGTCTGGCTTTGG - Intergenic
920931001 1:210387974-210387996 CTGCTGTCACTGTTTTAGATGGG + Intronic
921012304 1:211154513-211154535 CTGCTTTCACTGTATCCCATAGG - Intergenic
921113132 1:212058528-212058550 CTGCTTTTATTGTATCCCATGGG - Intronic
921371548 1:214428151-214428173 CTGCTGTCATTTTTTCTGACTGG - Intronic
921623782 1:217355484-217355506 CTGCTGTCAGTCTCTCACATAGG + Intergenic
924630243 1:245731268-245731290 CTGCTTTCACTGTATCCCATAGG - Intergenic
1063892902 10:10648530-10648552 TTGCTGTTATTCTTTCGCTTTGG - Intergenic
1064521295 10:16205048-16205070 CTGCTTTCACTGTATTGCATAGG + Intergenic
1065467460 10:26040034-26040056 CTGCTGTCACTGTATTCCATAGG + Intronic
1068125172 10:52830869-52830891 CTGCTTTTATTGTATCCCATAGG - Intergenic
1068278290 10:54832255-54832277 CTGCTGTGACTGATTCGGATGGG - Intronic
1070444988 10:76489667-76489689 CTGCTGTCATGGTATCTCCTAGG + Intronic
1076196653 10:128523297-128523319 CTGCTGTCATTGACTTGCACTGG + Intergenic
1078691890 11:13589790-13589812 CTGCTTTCACTGTATCTCATAGG - Intergenic
1078926922 11:15883677-15883699 CTCCTGTCATTGTTCTTCATTGG + Intergenic
1079640367 11:22797363-22797385 CTGCTGTAATTGTTTCCCTCTGG - Intronic
1084763485 11:71290799-71290821 CTGCTTTCATTGTATCCAATAGG + Intergenic
1085007831 11:73110829-73110851 CTGCTGTCGTTGTATCTCATGGG + Intronic
1086049647 11:82575288-82575310 CTACTGGCATTATTTGGCATAGG - Intergenic
1086249090 11:84793072-84793094 CTGCTTTCACTGTATCCCATAGG + Intronic
1087370960 11:97283143-97283165 CTGCTTTCATTGTATTCCATAGG - Intergenic
1087453948 11:98359375-98359397 TTGCTGCCATTGTATTGCATTGG - Intergenic
1087492115 11:98841576-98841598 CTTCTTTCATTGTTTCTCATAGG + Intergenic
1087720611 11:101661003-101661025 CTGCTTTCACTGTATCCCATAGG + Intronic
1088182144 11:107124891-107124913 CTGCTTTTGTTGTTTCCCATGGG - Intergenic
1091052204 11:132382851-132382873 CTGCTTTCACTGTATCCCATAGG - Intergenic
1092642703 12:10533831-10533853 CTGCTTTCATTGTATCCCATAGG - Intergenic
1093430803 12:19082746-19082768 TTGCTGTCAGTATTTCTCATAGG + Intergenic
1093538475 12:20251346-20251368 CTGCTTTCACTGTATCCCATAGG - Intergenic
1094690831 12:32767281-32767303 CTTCTGACATTGTTTCTCCTGGG + Intergenic
1095212935 12:39514541-39514563 CTGCTTTCACTGTATCTCATAGG - Intergenic
1097286914 12:57885097-57885119 CTGCTGTCATTCTGTGGCCTAGG + Intergenic
1097513135 12:60568260-60568282 CTGCTCTCATTGGCTGGCATTGG - Intergenic
1098396238 12:70020282-70020304 CTGCTTACATTGTATCCCATAGG - Intergenic
1099466769 12:82998155-82998177 GTGCTGTCAGTGTTTAGCATTGG + Intronic
1100060743 12:90572480-90572502 CTGCTTTCACTGTATCCCATAGG + Intergenic
1101025858 12:100605650-100605672 CTGCTTTCACTGTATCCCATAGG + Intronic
1101162288 12:101991004-101991026 CTGCTTTCACTGTTTCCTATAGG + Intronic
1101607869 12:106262418-106262440 CTGCTTTCACTGTATCCCATAGG - Intronic
1106075059 13:26452038-26452060 CTGCTTTCACTGTATCCCATAGG - Intergenic
1108161637 13:47646082-47646104 CTGCTTTCATTGTCTTGCAATGG + Intergenic
1109265665 13:60197240-60197262 CTGCTTTTATTGTATCCCATAGG + Intergenic
1109336361 13:60999920-60999942 CTGCTTTCACTGTATCTCATAGG + Intergenic
1110887986 13:80662415-80662437 CTGCTTTTATTGTATCCCATAGG + Intergenic
1112067213 13:95806076-95806098 CTCCTGTCTTTGTTTAGCCTTGG - Intronic
1117634493 14:57727551-57727573 CTGCTTTCACTGTGTCCCATAGG + Intronic
1117795079 14:59384908-59384930 CTGCTTTCATTGCATCCCATTGG + Intergenic
1118430547 14:65715617-65715639 CTGCTTTCACTGTATCCCATAGG + Intronic
1119634660 14:76264180-76264202 CTGCTGCCACTGTTTGGCCTGGG - Intergenic
1120588223 14:86342742-86342764 CTGCTGTTGTTGTATCCCATAGG + Intergenic
1121969794 14:98345496-98345518 CTGCTGTCATTATTTCTTAAGGG - Intergenic
1126275342 15:46872339-46872361 CTGCTGTCTTTGTTGCCCTTTGG + Intergenic
1127098978 15:55544609-55544631 CTGCCGTCATTGTTTCACTTGGG + Exonic
1131843971 15:96469216-96469238 CTGCAGTCATTGTTTCTAAGAGG + Intergenic
1133087367 16:3375444-3375466 CTACTGTCATTCTTTCTCAATGG - Intronic
1133627500 16:7584920-7584942 CTGATGTCATTGTTTCATTTAGG + Intronic
1135925796 16:26693026-26693048 CTGCTGTCATTGCTTTCCAGTGG - Intergenic
1136527710 16:30843162-30843184 CTGCTGTCATGGCCTCGCAGTGG - Intronic
1136714235 16:32264167-32264189 CTGCAGTCTTTGTTCCGGATGGG - Intergenic
1136753660 16:32665250-32665272 CTGCAGTCTTTGTTCCGGATGGG + Intergenic
1136814453 16:33205115-33205137 CTGCAGTCTTTGTTCCGGATGGG - Intronic
1136820929 16:33315195-33315217 CTGCAGTCTTTGTTCCGGATGGG - Intergenic
1136827492 16:33371734-33371756 CTGCAGTCTTTGTTCCGGATGGG - Intergenic
1136832558 16:33470505-33470527 CTGCAGTCTTTGTTCCGGATGGG - Intergenic
1138215938 16:55205336-55205358 CAGCTGTCATTGTTAGGAATTGG + Intergenic
1141226710 16:82123055-82123077 CTGCTTTCACTGTATCGGATAGG - Intergenic
1202993029 16_KI270728v1_random:28089-28111 CTGCAGTCTTTGTTCCGGATGGG - Intergenic
1203055818 16_KI270728v1_random:925602-925624 CTGCAGTCTTTGTTCCGGATGGG + Intergenic
1153610479 18:6879518-6879540 CGGCTGACATGGTTTCACATTGG + Intronic
1154931189 18:20998280-20998302 CTGCTTTCACTGTATCCCATTGG - Intronic
1155016523 18:21846526-21846548 CTCCTGTCATTGTTTCAAGTTGG + Intronic
1155495337 18:26436832-26436854 CTGCTGTGGTTGTTTCCCACTGG + Intergenic
1158014581 18:52768737-52768759 TTTCTGTCATTATTTAGCATAGG + Intronic
1159225205 18:65524296-65524318 CTGCTTTCACTGTATCCCATAGG - Intergenic
1159526354 18:69596168-69596190 CTGAGGTCATTGTTTTACATTGG - Intronic
1160068487 18:75602053-75602075 CTGCTTTCATTGTATCCCATTGG - Intergenic
1161165327 19:2783812-2783834 CTACTCTCATTATTTTGCATTGG + Intergenic
1162002791 19:7758029-7758051 CTGCTTTCATGGGTTGGCATTGG - Intergenic
1164675265 19:30096433-30096455 CTGCTATTATTATTTCACATTGG + Intergenic
1166407962 19:42535979-42536001 CTGCTTTCATTGTATCCCACAGG + Intronic
928301160 2:30126308-30126330 GTACTGTCATTGTTTGGCTTTGG - Intergenic
928535225 2:32233251-32233273 CTGCTTTCACTGTATCCCATAGG + Intronic
928807487 2:35177491-35177513 CTGTTGTCTTTGTTTGACATTGG + Intergenic
928912056 2:36431885-36431907 TTGCTGTCATTGTTGCACAAAGG + Intronic
930895129 2:56436977-56436999 CTGCTTTCATTGTATCCCAAAGG + Intergenic
936714746 2:115172859-115172881 CTTTTGTCATTGTTTGACATTGG + Intronic
939114160 2:138041353-138041375 CTGCTGTCAGTGTTCAGGATAGG - Intergenic
940795719 2:158075668-158075690 CTGCTTTCACTGTATCCCATAGG - Intronic
941227974 2:162872285-162872307 CTGCTTTTACTGTTTCCCATAGG - Intergenic
942863121 2:180639642-180639664 CTGCTTTCATTGTATCCCGTAGG - Intergenic
943067444 2:183103957-183103979 CTGCTTTCACTGTATCCCATAGG + Intergenic
943331497 2:186564898-186564920 CTGCTTTCACTGTATCCCATAGG - Intergenic
943966958 2:194348485-194348507 CTGCTGGCATTATTTAACATTGG - Intergenic
947130699 2:226921493-226921515 CTGCTTTCACTGTATCCCATAGG + Intronic
947439415 2:230105368-230105390 CTGCTTTCATTGTAGCCCATAGG + Intergenic
948324836 2:237106675-237106697 CTTTTGTCATTTTTTCCCATTGG - Intergenic
1170331629 20:15218473-15218495 CTACTGTCATGATTTTGCATGGG + Intronic
1170645937 20:18195797-18195819 CTTTTGTCAATGTTTCTCATTGG + Intergenic
1174939134 20:54904922-54904944 CTGCTTTCAGTGTATCCCATAGG - Intergenic
1175311873 20:58017998-58018020 ATGCTGTCATTATTTCCCTTTGG - Intergenic
1175976142 20:62711393-62711415 CTCCTGTCTTTGATTGGCATTGG + Intronic
1177873748 21:26605875-26605897 CTGCTTTCACTGTATCCCATAGG + Intergenic
1179129007 21:38617799-38617821 CTGTTGTCTTTGTTTCCCAAAGG + Intronic
1184274235 22:43401094-43401116 CTGCTGTGATTGTTTATCAAGGG + Intergenic
949162980 3:903645-903667 CTGCTTTCATTGTATATCATAGG - Intergenic
949311468 3:2703502-2703524 CTGTTATGATTGTTTCACATGGG - Intronic
951494003 3:23305144-23305166 GTACTGTCATTTTTTCCCATGGG + Intronic
955273994 3:57529894-57529916 CTGCTTTCACTGTATCCCATAGG + Intronic
957779025 3:84794210-84794232 CTGCTTTCACTGTATCCCATAGG - Intergenic
957903452 3:86528097-86528119 CTGCTTTCACTGTATCCCATAGG - Intergenic
959775381 3:110154143-110154165 CTGTTGTCATTGTTTGGTTTTGG + Intergenic
960826801 3:121795465-121795487 CTGCTGTGATTGCTTTGCAGAGG - Exonic
962078450 3:132111240-132111262 CTGCTTTCATTGTATCCCATAGG + Intronic
962668167 3:137677427-137677449 CTGCTTTCACTGTATCCCATGGG - Intergenic
963371013 3:144400375-144400397 CTGCTTTCACTGTATCCCATAGG + Intergenic
965322137 3:167263385-167263407 CTGCTTTCATTGTATCCTATAGG + Intronic
965358967 3:167713412-167713434 CTGCTTTCACTGTATCCCATAGG - Intronic
965526775 3:169728599-169728621 CTGCTTTCACTGTATCCCATAGG + Intergenic
965535270 3:169817096-169817118 CTGCTTTCACTGTATCCCATAGG + Intergenic
965579907 3:170256830-170256852 CTGCTTTCACTGTATCCCATTGG + Intronic
966329683 3:178796729-178796751 CTGCTTTCACTGTATCCCATAGG - Intronic
966667264 3:182485931-182485953 TTGCTGTCATTCATACGCATAGG + Intergenic
967345149 3:188447196-188447218 CTGATTTCATTGTTTTGCAGTGG + Intronic
970038826 4:11772689-11772711 GATCTGTCATTGTTTCCCATTGG - Intergenic
970442826 4:16097694-16097716 CTGCTTTCACTGTATCCCATAGG - Intergenic
973922722 4:55705008-55705030 CTGCTGTCCTTGTTTCTCCTTGG + Intergenic
974878571 4:67726334-67726356 ATGCTCTTATTGTTTGGCATTGG + Intergenic
975312812 4:72921967-72921989 TTGTTTTCACTGTTTCGCATGGG + Intergenic
976931010 4:90567246-90567268 CTGCTGTTGCTGTTTCCCATAGG + Intronic
978297914 4:107229909-107229931 CTGCTTTCACTGTATCCCATAGG - Intronic
983490802 4:168386773-168386795 CTGCTGTCATTGTTTCGCATGGG - Intronic
983683677 4:170382315-170382337 CTGCTCTCACTGTATCCCATAGG + Intergenic
988608013 5:32698149-32698171 CTGCTTTCACTGTATCCCATGGG + Intronic
989633698 5:43512453-43512475 TTACTGACATTGTTTCGCAATGG + Intronic
989822618 5:45812647-45812669 CTGCTGGTATTGTTTTTCATGGG - Intergenic
989974590 5:50569065-50569087 CTGCTTTCAGTGTGTCCCATAGG - Intergenic
990637300 5:57743248-57743270 CACCTGACATTGTTTCCCATGGG + Intergenic
990957715 5:61360269-61360291 CTGTTGACAGTGTTTCCCATGGG + Intronic
992706646 5:79401944-79401966 CTGTTTCCATTGTTTCACATTGG + Exonic
993147991 5:84120973-84120995 CTACTGTCACTGTTACCCATTGG - Intronic
994226500 5:97257585-97257607 CTGCTTTCACTGTATCCCATAGG - Intergenic
996166006 5:120224877-120224899 CTGCTTTCACTGTATCCCATAGG + Intergenic
1000539099 5:162517167-162517189 CTGCTTTCATTGTATCTCATAGG + Intergenic
1004332636 6:14735672-14735694 CTGCTGTCCTTGTTTCTATTGGG - Intergenic
1005345675 6:24887638-24887660 CTGCTGTCATTGCTTTGAAGAGG - Intronic
1005662340 6:28011506-28011528 CTGCTGTGATTGCTTTGCAGAGG + Intergenic
1005779525 6:29174592-29174614 CTGTTGTCATTGTTTTTCCTAGG + Intergenic
1007022383 6:38533867-38533889 CTGCTTTCATTGAATCCCATAGG - Intronic
1007236849 6:40396605-40396627 CTGCTGGCCTTGTTTCTGATGGG - Intronic
1007525031 6:42484536-42484558 CTTCTGTAAATGTTTCTCATTGG + Intergenic
1008641739 6:53470485-53470507 CTGCTTTCACTGTATCCCATAGG + Intergenic
1013575522 6:111481286-111481308 GTGCTGTCTTTGTTTCCAATTGG - Intronic
1014430671 6:121366655-121366677 CTGCTTTCACTGTATTGCATAGG - Intergenic
1014826779 6:126056041-126056063 CTTTTGCCATTGTTTCACATGGG - Intergenic
1015583782 6:134755190-134755212 GTGCTATCATTGGTTCCCATGGG + Intergenic
1016859408 6:148701718-148701740 CTGCTGTAATTGGTTTTCATAGG + Intergenic
1021124013 7:16829652-16829674 CTGCTTTCACTGTATCCCATAGG - Intronic
1022541690 7:31142790-31142812 CTGCTTTCATTTTATCCCATAGG + Intergenic
1025800006 7:64777299-64777321 CTGCTGTCTTTGGTTTTCATGGG + Intergenic
1028186534 7:87792688-87792710 CTGCTTTCAGTGTATCCCATAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030390609 7:108922900-108922922 CTGCTGTCACTGTATCCCATAGG + Intergenic
1031638823 7:124137042-124137064 CTGCTTTTATTGTATCCCATAGG + Intergenic
1032352359 7:131176854-131176876 TGGCTGTCACTGTTTCCCATTGG - Intronic
1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG + Intronic
1034409320 7:150931256-150931278 CTCCTGTCATTGATTCTCATTGG - Intergenic
1034855034 7:154536766-154536788 CTGCAGTCATTGGGTCACATGGG - Intronic
1035099583 7:156385127-156385149 CTGCTGTCATTGCATCTCAGTGG + Intergenic
1037000443 8:13711329-13711351 CTGCTTTCATTGTATTCCATAGG + Intergenic
1037993097 8:23334434-23334456 CTGTTTTCATTGTTTCTCATTGG - Intronic
1038114924 8:24543241-24543263 CTGCTGCCATTTTTTCCCCTTGG + Intergenic
1038360677 8:26872844-26872866 CTGCTGTAGTTGTTTCACGTAGG + Intergenic
1039690847 8:39862915-39862937 TTCCTGCCATTGTTTCCCATTGG - Intergenic
1043235531 8:77861063-77861085 CTGCTTTCACTGTATCCCATAGG - Intergenic
1044363120 8:91311112-91311134 CTGCTGAAGTTGTTTCCCATGGG - Intronic
1046864373 8:119129500-119129522 CTCCTGCCATTGTTCCTCATTGG + Intergenic
1047311321 8:123694885-123694907 CTGCTGTCAGTGTATCCCATTGG + Intronic
1049132392 8:140858758-140858780 CTTCTGTAATTGTTTGGCACAGG - Intronic
1049919279 9:348052-348074 CTGTTGTCATTTTTTCGCAAAGG + Intronic
1050392545 9:5160427-5160449 CTGCTTTCCCTGTATCGCATAGG - Intronic
1052204554 9:25823677-25823699 CTGCTTTCACTGTATCTCATAGG + Intergenic
1055393414 9:75847662-75847684 CTGTTGTGATTGTTTCAAATTGG + Intergenic
1055911100 9:81352966-81352988 CTGCTTTCGTTGTATCTCATAGG - Intergenic
1056146414 9:83734932-83734954 CTGCTTTCACTGTGTCCCATAGG + Intergenic
1186178001 X:6945174-6945196 CTGATGTCAGTGTTTGGCTTTGG + Intergenic
1186454579 X:9701092-9701114 GTGCTGTCATTTTATCACATGGG - Intronic
1187798805 X:23036086-23036108 CTGCTGTCATTGGATTGCTTGGG + Intergenic
1187838575 X:23460693-23460715 CTGCTTTCACTGTATCCCATAGG + Intergenic
1188077925 X:25802286-25802308 CTGCTTTCACTGTATCCCATAGG + Intergenic
1188650717 X:32628677-32628699 CTGCTTTCACTGCTTCCCATAGG + Intronic
1188814168 X:34690758-34690780 CTGGTTTCCTTGTATCGCATTGG + Intergenic
1190367915 X:49714741-49714763 CTGCTTTCACTGTATCCCATAGG + Intergenic
1192304122 X:69940931-69940953 CTGCTTTCACTGTATCCCATAGG + Intronic
1192959775 X:76115793-76115815 CTGCTTTCACTGTATCCCATAGG - Intergenic
1193022839 X:76810276-76810298 CTGCTTTCACTGTATCCCATAGG - Intergenic
1194572148 X:95565847-95565869 CTGCTTTCACTGTATCCCATAGG - Intergenic
1196532298 X:116802942-116802964 CTGCTTTCACTGTATCTCATAGG + Intergenic
1197003205 X:121464111-121464133 CTGCTTTCATCGTATCCCATAGG + Intergenic
1197512259 X:127384873-127384895 CTGTTGTCATTATTATGCATAGG + Intergenic
1197810742 X:130440985-130441007 CTACTTTCATTGTATCCCATAGG + Intergenic
1198956691 X:142139759-142139781 CTGCTTTCACTGTATCCCATCGG - Intergenic
1199037309 X:143067047-143067069 CTGCTTTCACTGTATCCCATGGG - Intergenic
1199339930 X:146665685-146665707 ATGCTGTCTTTGTTTGGCTTAGG - Intergenic
1199362481 X:146938865-146938887 CTGCTTTCACTGTCTCCCATAGG + Intergenic
1201075685 Y:10185485-10185507 CTGCTGGCATAGTTTCACAATGG + Intergenic