ID: 983494494

View in Genome Browser
Species Human (GRCh38)
Location 4:168427960-168427982
Sequence TTGCAGGGCCAGGAACTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983494494_983494502 1 Left 983494494 4:168427960-168427982 CCCATCAGTTCCTGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 162
Right 983494502 4:168427984-168428006 TAGGGCTGCCAAAGGAGCAGAGG 0: 1
1: 0
2: 1
3: 31
4: 277
983494494_983494505 14 Left 983494494 4:168427960-168427982 CCCATCAGTTCCTGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 162
Right 983494505 4:168427997-168428019 GGAGCAGAGGTGCACAGCCTGGG 0: 1
1: 0
2: 4
3: 46
4: 360
983494494_983494506 21 Left 983494494 4:168427960-168427982 CCCATCAGTTCCTGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 162
Right 983494506 4:168428004-168428026 AGGTGCACAGCCTGGGCCCCAGG 0: 1
1: 0
2: 3
3: 28
4: 455
983494494_983494501 -7 Left 983494494 4:168427960-168427982 CCCATCAGTTCCTGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 162
Right 983494501 4:168427976-168427998 CCTGCAATTAGGGCTGCCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 135
983494494_983494504 13 Left 983494494 4:168427960-168427982 CCCATCAGTTCCTGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 162
Right 983494504 4:168427996-168428018 AGGAGCAGAGGTGCACAGCCTGG 0: 1
1: 0
2: 2
3: 34
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983494494 Original CRISPR TTGCAGGGCCAGGAACTGAT GGG (reversed) Intronic
901014610 1:6221316-6221338 TTGCAAGGAGAGGAACTGAACGG - Exonic
901720501 1:11193488-11193510 CTGCAGGGACAGGAACAGGTTGG + Intronic
902761324 1:18582695-18582717 TTCGAAGGCCAGGAACTCATGGG - Intergenic
905270137 1:36782258-36782280 TAGGAGAGTCAGGAACTGATGGG - Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
912420544 1:109539652-109539674 TCGTGGGGCCAGGAAATGATAGG - Intergenic
914205005 1:145519077-145519099 ATACAGGGGCAGGAGCTGATGGG - Intergenic
914484124 1:148092259-148092281 ATACAGGGGCAGGAGCTGATGGG - Intergenic
914689483 1:150012733-150012755 TTTAGGGGCCAGGAAGTGATGGG + Intergenic
921666989 1:217884514-217884536 TAGAAGGGCCAGGAGCTGGTGGG - Intergenic
922274849 1:224067987-224068009 TTGCAGTTTTAGGAACTGATGGG - Intergenic
923518684 1:234719565-234719587 TTGCAGGGGCAGAAGCTGAAAGG - Intergenic
924039732 1:239972619-239972641 TTGCAGGGCGTGCAACTGAGCGG + Intergenic
1063630510 10:7729377-7729399 TTCCAGGGACAGGAACTGAATGG - Intronic
1064516916 10:16160006-16160028 TTTCAAGGCAGGGAACTGATTGG - Intergenic
1065643880 10:27814463-27814485 TGGCAGGCCAAGGAACTGAGAGG - Intronic
1067255226 10:44631471-44631493 CAGCAGGGCCAAGAACTTATGGG + Intergenic
1074189601 10:111124341-111124363 TAGCAGGGCCTGGAGCTGACAGG - Intergenic
1074679364 10:115888409-115888431 TTTCAGGGCCAGAAGATGATAGG + Intronic
1074874984 10:117606760-117606782 TGGTGGGGCCTGGAACTGATGGG - Intergenic
1075321614 10:121495745-121495767 TTGCAGTGCCAGGAATTCCTTGG - Intronic
1075663910 10:124217370-124217392 CTGCAGGGACAGGTACTGTTTGG - Intergenic
1076288446 10:129324659-129324681 TTGGAGGGCTAAGAACTGAGAGG + Intergenic
1076599827 10:131650351-131650373 AGGCCGGGCCAGGAACTGACTGG + Intergenic
1078813486 11:14795484-14795506 GTGCTGGGCCAGGACATGATGGG + Intronic
1082561939 11:54628491-54628513 CTGCTGGGCCAGGTACTGAGAGG - Intergenic
1085046012 11:73354137-73354159 TTGCTGACCCAGAAACTGATGGG + Intronic
1089365741 11:117919949-117919971 CTGCAGGGCCAGGAACACCTTGG + Intronic
1091344054 11:134840897-134840919 TTGCTGGGCCATGAACAGAGAGG - Intergenic
1092204558 12:6607148-6607170 CTGCAGGGCCAGGAAAGGAAGGG + Intronic
1095788079 12:46132679-46132701 TTGCAGAGCCAGGATGTGATTGG + Intergenic
1095980258 12:47969005-47969027 TTGCTGTGACAGGAACTCATGGG - Intergenic
1096124757 12:49110916-49110938 TTCCAGGGGGAGGAACTCATTGG + Intergenic
1098556768 12:71827304-71827326 TTTCAAGGCAGGGAACTGATTGG + Intergenic
1101963665 12:109267725-109267747 CTGCAGAGCCAGGAGCTGCTGGG - Exonic
1102017558 12:109657668-109657690 CTGCAGAGCAAGGAACAGATTGG + Intergenic
1104171648 12:126287311-126287333 TTTCATGTCCAGAAACTGATAGG + Intergenic
1105007068 12:132728079-132728101 GTGCACGGCCGGGAACTGATGGG + Exonic
1106061422 13:26296508-26296530 TTCCAAGAGCAGGAACTGATGGG + Intronic
1107460184 13:40594442-40594464 TCACAAGGCCAGGAAGTGATGGG + Intronic
1109055662 13:57544923-57544945 GTCCTGGGCCAGGAATTGATGGG + Intergenic
1112416798 13:99209493-99209515 TTTGTGGGCCAGGAACTGTTTGG + Intronic
1118755708 14:68842336-68842358 TTTCAGGGACATGTACTGATTGG + Intergenic
1119415250 14:74465491-74465513 TTGCATGGCAAGGAAGTGAGAGG - Intergenic
1119601627 14:75980675-75980697 GTAAAGGGCCAGGACCTGATAGG + Exonic
1119647255 14:76356777-76356799 TTGCAGGACCATGCGCTGATGGG - Intronic
1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1124653618 15:31489941-31489963 GTGAAGGGCCAGGTACTGAGAGG + Intronic
1126767235 15:52020660-52020682 TTTCAGGGCCAGGCCCTGTTTGG - Intronic
1129740822 15:77988798-77988820 TTGCAGGGCCAGGTGGTGTTGGG - Intronic
1133737926 16:8629813-8629835 GAGCTGGGCCAGGAAGTGATCGG + Intronic
1135728498 16:24875531-24875553 TTGCGGGGGCAGGAGCAGATGGG + Intronic
1136385203 16:29920956-29920978 TTGTAGGGGCAGGAACTGGAAGG + Intronic
1137001778 16:35235377-35235399 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1137018059 16:35395246-35395268 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1138536428 16:57662815-57662837 CTGCACGGCCAGGAACAGAGGGG - Intronic
1140168001 16:72574409-72574431 TTGCTGGGCCAGGGACTGTGTGG - Intergenic
1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG + Intergenic
1141761161 16:86029559-86029581 GTGCAGAGCCAGGCACTGCTGGG - Intergenic
1143487237 17:7261690-7261712 CTGCAGGGCGAGGAAGTGGTCGG - Intronic
1145304444 17:21665558-21665580 GTTCAGGGACAGGAACTGGTGGG + Intergenic
1148214065 17:45824932-45824954 TGGCAGAGCCAGGCACGGATGGG - Intronic
1151129011 17:71876452-71876474 TTGCAGATACAGGAATTGATAGG - Intergenic
1151579115 17:74968267-74968289 TGGCAAGGTCAGGGACTGATGGG - Intronic
1151583340 17:74992588-74992610 TTGCAGAGCAGGGAACTGAGTGG - Intronic
1152111991 17:78361583-78361605 TTGCCGGCCCTGGAATTGATAGG + Intergenic
1152887375 17:82860350-82860372 GTGGAGGGGCAGGAACTGACTGG + Intronic
1153652745 18:7255654-7255676 TTGCACTGCCAGGAAGTGACTGG - Intergenic
1156559904 18:38111892-38111914 TAGCATTGCCAGGACCTGATTGG - Intergenic
1160298402 18:77657874-77657896 CAGCAGGGCCAGGGACTGAAGGG + Intergenic
1162797792 19:13095588-13095610 GGGCAGGGGCAGGAACTGATGGG - Exonic
1163792271 19:19314574-19314596 GGGCAGGCCCAGGAACTGAGGGG - Intronic
1164984056 19:32635264-32635286 TTGCAGGGCAAGAAACAGATTGG - Intronic
1166267781 19:41695771-41695793 TTGCAGGCTCAGGATCTGAGGGG - Intronic
1166411010 19:42555435-42555457 TTGCAGGCTCAGGATCTGAGAGG - Intronic
1167092353 19:47353351-47353373 TGGCAGGGCCAAGAACAGAGAGG - Exonic
1167650261 19:50724911-50724933 AGGCGGGGCCAGGAACTCATGGG - Intronic
1168142582 19:54399043-54399065 TTTCATGGCAAGGAACTGAGGGG - Intergenic
1168721632 19:58557803-58557825 TTGGAGGACCAGGGACTCATGGG - Intronic
925481801 2:4283779-4283801 TGCCAGGGGCAGGAACTGATGGG - Intergenic
925922584 2:8647294-8647316 TTGGAGGGCCAGGAACAGGCAGG + Intergenic
925994377 2:9280049-9280071 TTGCAGGGCTAGGAACTGTGAGG + Intronic
928096750 2:28409562-28409584 CTGCAGGGCCAGGCTCTGAAGGG - Intronic
930100013 2:47596267-47596289 ATCCAGGCCCAGGAACTGAGTGG + Intergenic
932334230 2:70920776-70920798 TTGCAGAGTAAGGAACAGATGGG - Intronic
933639315 2:84741974-84741996 TTGCGCAGCCAGGAACTGACTGG - Intronic
933757076 2:85648117-85648139 TTGGAGGGCCAGGTACCTATTGG + Intronic
935448294 2:103180041-103180063 TTGCAGGGCAAGGAAATAACAGG + Intergenic
935523739 2:104141483-104141505 TGCCAGGGCCAGAAACTGGTAGG + Intergenic
937015680 2:118603146-118603168 TTTCATGGCCAGGAACTTTTTGG - Intergenic
946132693 2:217619509-217619531 TTGCAGGGCCAAAAAGTGAGGGG + Intronic
947997715 2:234543000-234543022 AAGCAGGGCCAGGCCCTGATAGG - Intergenic
948267503 2:236646090-236646112 TTGCAGGGATGGGATCTGATGGG + Intergenic
948692654 2:239716505-239716527 TTGCAGGGCCAGGTAGTAACTGG - Intergenic
948923137 2:241076048-241076070 TTGTAAGTCCTGGAACTGATTGG + Intronic
1171521961 20:25782990-25783012 GTTCAGGGACAGGAACTGGTGGG + Intronic
1171554864 20:26072893-26072915 GTTCAGGGACAGGAACTGGTGGG - Intergenic
1173177145 20:40773078-40773100 TTGCAGGGACAGGGACCAATGGG + Intergenic
1174518586 20:51112680-51112702 TTCCAGTGCCAGGCACTGAGTGG - Intergenic
1174768009 20:53271983-53272005 TTGCAGGGCTGGGAAGTGAGTGG + Intronic
1180055007 21:45353059-45353081 GTGCAGGGCCAGGACCTGCCGGG - Intergenic
1185379831 22:50503271-50503293 CTGCAGGGCCAGGCACAGGTTGG - Exonic
950813148 3:15669989-15670011 TTGCAGTGCCAGGAACAATTGGG - Exonic
950818854 3:15736454-15736476 TTGCAGGGGTAGGAACTTATAGG - Intronic
953575767 3:44112073-44112095 TTGGAGGTCCAGGAAGTGACTGG + Intergenic
959466434 3:106693025-106693047 TCTCAGGGCCAGGAACTCATTGG + Intergenic
962413494 3:135161913-135161935 ATGCAGGACCAAGAAATGATGGG + Intronic
966537898 3:181054454-181054476 TTGAAGGGCAAGGAACAGAGTGG - Intergenic
966687170 3:182708751-182708773 CTTCAGGGGCAGGAACTGAGAGG - Intergenic
969305292 4:6322891-6322913 TTGCAGGGACCGGAGCTGATGGG - Exonic
969868476 4:10090677-10090699 GTGCAGGGCCAGGGCCTGCTGGG - Intronic
977977231 4:103279786-103279808 TTGCAGTGGCAGGTACTGGTTGG - Intergenic
979001797 4:115230481-115230503 TTGCACAGAAAGGAACTGATTGG + Intergenic
979037958 4:115749620-115749642 TAGCAAGGGCAGAAACTGATAGG - Intergenic
981038526 4:140197212-140197234 GTCCAGGGTCAGGAACTGATTGG - Intergenic
983494494 4:168427960-168427982 TTGCAGGGCCAGGAACTGATGGG - Intronic
984716803 4:182933529-182933551 TAGGAAGCCCAGGAACTGATTGG - Intergenic
986614949 5:9606552-9606574 TTGCTGGGGCAGGAACTCTTTGG - Intergenic
987090069 5:14502573-14502595 TTGCAGGTCCAGGGATGGATGGG + Exonic
987731237 5:21775324-21775346 ATGCAGGCCTAGGAACAGATAGG + Intronic
988083793 5:26446826-26446848 TGTCAGGGGCAGGACCTGATGGG - Intergenic
998797997 5:145839231-145839253 ATGCAGGGGCAGAAACTGAGTGG + Intergenic
1001954134 5:175836820-175836842 TTGCAGGGCAAGGATCAGCTGGG - Intronic
1002072502 5:176688489-176688511 TTGTGGGGCCAGGAACAGACAGG - Intergenic
1003661127 6:8063843-8063865 TCGCACGACCAGGAACAGATCGG + Intronic
1003873694 6:10419746-10419768 TTCCCGGGCCAGGGACTGACCGG - Intergenic
1004819469 6:19351325-19351347 TTGTAGAGCCTGGAACTTATTGG - Intergenic
1006735127 6:36267965-36267987 TCTCAGGGCCAGGGACTGGTTGG - Intronic
1006975000 6:38091711-38091733 TAGTAGAGCCAGGAACTGAGTGG - Intronic
1007608445 6:43132781-43132803 CTGCAGGGCCCAGAACTGAGAGG - Intronic
1011698295 6:89932753-89932775 ATGCAGGGCCTGGATCTGCTCGG + Exonic
1016667388 6:146657760-146657782 GTTCAGGACCAAGAACTGATGGG - Intronic
1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG + Intergenic
1018609437 6:165633318-165633340 TTTCAGGGACATGAACTGAATGG - Intronic
1019270183 7:142701-142723 TTGCAGAGTCAGGAATTGCTGGG - Intergenic
1022625816 7:32034789-32034811 TTCCAAGGTCAGGAAATGATGGG - Intronic
1023584300 7:41713225-41713247 TTAAAGGGCCAGGAACTAACAGG - Intergenic
1025282461 7:57638172-57638194 GTTCAGGGACAGGAACTGGTGGG + Intergenic
1025302262 7:57827235-57827257 GTTCAGGGACAGGAACTGGTGGG - Intergenic
1025921571 7:65918110-65918132 TTGCGGGGTAGGGAACTGATTGG - Intronic
1026037467 7:66840054-66840076 CTGGAGGGCCAGGGACTGATGGG - Intergenic
1026376967 7:69761556-69761578 GTGCAGGGTCAGGGACTGAGGGG + Intronic
1027798598 7:82723948-82723970 TTGCAAGGTGAGGAACTGGTTGG + Intergenic
1027933521 7:84571121-84571143 TTGCAGGATCAGGGACGGATAGG - Intergenic
1029796431 7:102899504-102899526 TTGCAGGGCCTGGAGCGTATAGG - Intronic
1034136117 7:148771786-148771808 TTGCTGGCCCAGGAACAGGTTGG + Intronic
1034252314 7:149702033-149702055 TTGGGGGGCCAGGAACAGGTGGG - Intergenic
1036287442 8:7456352-7456374 TTGCGGGGCAAGGAACAGGTGGG - Intronic
1036334038 8:7855173-7855195 TTGCGGGGCAAGGAACAGGTGGG + Intronic
1038247140 8:25869362-25869384 CAGCAGGGCAAGGAAGTGATGGG - Intronic
1039601099 8:38838160-38838182 CTGCAGGGCCAGGCCCTGACTGG - Intronic
1041930302 8:63279522-63279544 TTGCATGGCAAGGAACTGAGGGG - Intergenic
1047438848 8:124858503-124858525 TTGCAGCTCCAGGGACTGAAAGG - Intergenic
1048303695 8:133268771-133268793 CTGGGGGGCCAGGAACTGAGTGG - Intronic
1048987891 8:139745072-139745094 CTGCATGGCCAGGACCTGCTGGG + Intronic
1049531919 8:143159361-143159383 CTCCAGGGCCTGGAACTGGTGGG - Intronic
1049655667 8:143795888-143795910 TAGCAGGCACTGGAACTGATGGG + Intronic
1052837961 9:33265347-33265369 TGGCAGGGCAAGGCAGTGATGGG - Intronic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1055079950 9:72258921-72258943 TTGCAGGGCCAGCCAGGGATTGG + Intergenic
1055425289 9:76189088-76189110 TTTAAGGGGCAGGAGCTGATGGG + Exonic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1059337858 9:113580437-113580459 TTCCAGGGCCAGGCACTGTGAGG + Intronic
1059958742 9:119544827-119544849 CTCCAGGGCCAGGAACTGAGGGG - Intergenic
1060368587 9:123045962-123045984 TTGCAGGACCTGGAAGTCATTGG - Intronic
1060825579 9:126685887-126685909 TTCCAGTGCTAGGAAGTGATAGG + Intronic
1061315361 9:129792344-129792366 TTGCAGAGAGAGGACCTGATTGG - Intergenic
1062160445 9:135076714-135076736 TTGCAAGTCCAGGAAGTGATGGG + Intronic
1062424159 9:136498320-136498342 CTGCAGGGCCAGGAGCTGCAGGG + Intronic
1062451510 9:136617617-136617639 TTGCAGGGCCTGGGGCTGGTTGG + Intergenic
1186737201 X:12478242-12478264 TTCCAAGGACAGGAACTGACAGG + Intronic
1190143835 X:47872615-47872637 TTGCAGGCTTAGGAACTAATGGG + Intronic
1197032192 X:121829986-121830008 TTGCAGGGGCTAGAACTTATGGG + Intergenic
1199643476 X:149883973-149883995 TGGTAGGGCCAGGAACTGTGGGG - Intronic