ID: 983495558

View in Genome Browser
Species Human (GRCh38)
Location 4:168438662-168438684
Sequence TGTCACAAAGCACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1013
Summary {0: 1, 1: 3, 2: 26, 3: 190, 4: 793}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983495558_983495563 4 Left 983495558 4:168438662-168438684 CCAGCTTGTGGTGCTTTGTGACA 0: 1
1: 3
2: 26
3: 190
4: 793
Right 983495563 4:168438689-168438711 CCCTGGAAAAGGAGGACCTCAGG 0: 1
1: 0
2: 4
3: 14
4: 217
983495558_983495566 27 Left 983495558 4:168438662-168438684 CCAGCTTGTGGTGCTTTGTGACA 0: 1
1: 3
2: 26
3: 190
4: 793
Right 983495566 4:168438712-168438734 CAAAGAACCATGACCAGCTTAGG 0: 1
1: 4
2: 16
3: 62
4: 273
983495558_983495561 -4 Left 983495558 4:168438662-168438684 CCAGCTTGTGGTGCTTTGTGACA 0: 1
1: 3
2: 26
3: 190
4: 793
Right 983495561 4:168438681-168438703 GACAGCAACCCTGGAAAAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 227
983495558_983495560 -7 Left 983495558 4:168438662-168438684 CCAGCTTGTGGTGCTTTGTGACA 0: 1
1: 3
2: 26
3: 190
4: 793
Right 983495560 4:168438678-168438700 TGTGACAGCAACCCTGGAAAAGG 0: 1
1: 0
2: 0
3: 30
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983495558 Original CRISPR TGTCACAAAGCACCACAAGC TGG (reversed) Intronic
900628762 1:3622814-3622836 TGTCACAATGCATCACAAACTGG - Intergenic
900829959 1:4958921-4958943 TATAACAAATTACCACAAGCTGG + Intergenic
900894579 1:5474300-5474322 TGTAACAAAACACCACAGACTGG - Intergenic
901145202 1:7060164-7060186 CATAACAAAGCACCACAAACAGG + Intronic
901528478 1:9839015-9839037 TGTAACAAAGTACCACACACTGG - Intergenic
901675880 1:10884306-10884328 TGTGACAAAACACCAGCAGCAGG + Intergenic
902489841 1:16773235-16773257 TGTAACAAATTACCACAAACTGG + Intronic
903473674 1:23605087-23605109 TATAACAAAGTACCACAAGCTGG - Intronic
903503510 1:23815789-23815811 TGTAAGAAAGCACTACAGGCCGG - Intronic
905653775 1:39672864-39672886 TATAACAAATCACCCCAAGCTGG - Intergenic
905861736 1:41356646-41356668 TGTGATAAAGTACCACAAACTGG - Intergenic
906115806 1:43356398-43356420 TGTAACAAAGTACCACAAACTGG - Intergenic
906167294 1:43696236-43696258 GGTCACTAAGTACCACAAACTGG + Intronic
906365033 1:45201299-45201321 TGTAACAAAGTATCACAAACTGG - Intronic
907258929 1:53201560-53201582 TATAACAAAACACCACAAACTGG - Intronic
907557780 1:55359615-55359637 TATCACAAAGCACCACAAACTGG - Intergenic
907582832 1:55587420-55587442 TGTAACAAAGAACCACAAACTGG + Intergenic
907683861 1:56590809-56590831 TGTAACAAATTACCACAAGTTGG - Intronic
908289908 1:62655067-62655089 TGTAACAAAGTACTACAAACTGG - Intronic
908572323 1:65422494-65422516 CGTTACAAAGTACCACAAACTGG - Intronic
908662286 1:66449925-66449947 TGTAACAAAATACCACAAACTGG + Intergenic
908742113 1:67339622-67339644 TTTCACAAAGCACTGAAAGCTGG + Intronic
909062604 1:70896564-70896586 TGTAACAATTTACCACAAGCTGG - Intronic
909538902 1:76769140-76769162 TGTGACAAAGTACCACAAACTGG + Intergenic
909704744 1:78568303-78568325 CTTAACAAAGCACCACAAACTGG - Intergenic
909866724 1:80682656-80682678 CATAACAAAGCACCACAGGCTGG - Intergenic
909892474 1:81025045-81025067 TGTCACCAAGTATCACAAACTGG + Intergenic
910162182 1:84285245-84285267 TGTAATAAAGTACCACAAACTGG + Intergenic
910882895 1:91938534-91938556 CGTAAGAAAGTACCACAAGCTGG - Intergenic
910959550 1:92747387-92747409 TGTTACAAAGTACCACAAACTGG + Intronic
911154555 1:94625379-94625401 TATAACAAAGTGCCACAAGCTGG + Intergenic
911232451 1:95375236-95375258 TGTAACAAAGTACCACAGACTGG - Intergenic
911834186 1:102595049-102595071 TGTAACAAATGACCACAAACTGG - Intergenic
911933262 1:103932250-103932272 TGTAACAAATTACTACAAGCTGG + Intergenic
912176848 1:107169503-107169525 TGCCAAGAAGCACCTCAAGCAGG + Intronic
912582294 1:110731396-110731418 TGTAACAAAGTACCACAAACTGG - Intergenic
912995163 1:114525900-114525922 TGTAACAAATGACCACAAACAGG + Intergenic
913967719 1:143391068-143391090 TGTAACAAAATAGCACAAGCTGG - Intergenic
914062097 1:144216658-144216680 TGTAACAAAATAGCACAAGCTGG - Intergenic
914117053 1:144749696-144749718 TGTAACAAAATAGCACAAGCTGG + Intergenic
914334372 1:146701247-146701269 TGTAACAGGTCACCACAAGCTGG + Intergenic
915048354 1:153039974-153039996 TGTCACAGATCATCACAGGCAGG + Exonic
916245270 1:162681503-162681525 TGTCACAAACTACCATATGCAGG + Intronic
916253786 1:162765696-162765718 TGTCATAAAGCATAAGAAGCAGG - Intronic
916644257 1:166766833-166766855 TATAACAAAGTACCACAAACTGG + Intergenic
916732516 1:167579392-167579414 TGTAACAAAGCACCACAAACTGG - Intergenic
916985401 1:170185888-170185910 TGTCAAAAAGCAACAGATGCTGG - Intergenic
916999511 1:170341031-170341053 TGTGAAAAAGCACCACAAAAAGG - Intergenic
917262678 1:173187219-173187241 TGTCACAAAGCACCTATAGCAGG + Intronic
917294861 1:173507887-173507909 TGTAACAAAGTACCACAAACTGG - Intronic
917608307 1:176659190-176659212 TGTAACAAAGCCCCACAAACTGG + Intronic
917739617 1:177949986-177950008 TGTCACAAAGTACTAAATGCAGG - Intronic
917753505 1:178076184-178076206 TATGACAAAGCACCACAGACTGG - Intergenic
917950738 1:180031820-180031842 CCTCACAAAGCACCCTAAGCAGG - Intronic
918525396 1:185458905-185458927 TGTAACAATGTACCACAAACTGG - Intergenic
919150090 1:193685433-193685455 TATAACAAAGTACCACAAACTGG + Intergenic
919156122 1:193767818-193767840 GGTAACAAAGTACCACAAACTGG - Intergenic
919319111 1:196011898-196011920 TGTAACAAAGTATCACAAACTGG + Intergenic
919413342 1:197274887-197274909 TGTAACAAAGTACTACAAACTGG + Intronic
920196551 1:204231066-204231088 TGTGACAAATCACCACACACAGG - Intronic
920740274 1:208575370-208575392 TGTAACAAAGTACCACAACCTGG + Intergenic
920942726 1:210499251-210499273 TGTCACAATGCAGCATAGGCAGG - Intronic
920945878 1:210528191-210528213 TGTCACAATGCACCAGACCCAGG + Intronic
921252846 1:213313637-213313659 TGCCACAAAGTATCACAAACTGG + Intergenic
921716460 1:218422043-218422065 AGTAACAAAGTACCACAAACTGG - Intronic
922259385 1:223923736-223923758 TGTAATAAAGTACCACAAACTGG - Intergenic
922326513 1:224533470-224533492 TGTAACAAATCACCACAAATTGG + Intronic
922711194 1:227834260-227834282 TGTCACAAAGTACCCCAAACTGG - Intronic
922918118 1:229275468-229275490 CATCACAAAGAACCACAAACTGG - Intronic
923143202 1:231179063-231179085 CATCACAAATTACCACAAGCTGG + Intronic
923530599 1:234809293-234809315 TGTAACAAATTACCACAAACTGG - Intergenic
923766987 1:236901553-236901575 TGTAACAAAATACCACAAACTGG + Exonic
924333742 1:242966328-242966350 TATAACAAAGCACCACAGCCTGG + Intergenic
924340566 1:243026483-243026505 TGTAATAAAGTACCACAAACTGG - Intergenic
924421500 1:243914234-243914256 AGTAACAAAGTACCACAAACTGG - Intergenic
924493316 1:244561469-244561491 CGTAACAAAGTACCACAAACTGG + Intronic
1062876374 10:946005-946027 CGTAACAAAACACCACAGGCTGG - Intergenic
1063003636 10:1947608-1947630 TGTAACAAAGTATCACAAACTGG + Intergenic
1063133727 10:3199089-3199111 CGCCACAAAGCACCACAGACTGG - Intergenic
1063160581 10:3415511-3415533 TGTAACAAAGCACCATAGACGGG + Intergenic
1063536811 10:6891538-6891560 TGTCACAAAGCATCACACACTGG + Intergenic
1064071497 10:12232734-12232756 TGGCAGAAAGCACCACAGCCAGG - Intronic
1064516024 10:16149286-16149308 TATCTCAAAGCATGACAAGCTGG + Intergenic
1064601551 10:16998549-16998571 TGTAACTAAGTACCACAAACTGG - Intronic
1064726763 10:18287937-18287959 TGTCAGCAAACACCAGAAGCTGG - Intronic
1064980124 10:21158087-21158109 TGTGACAAAGTACCATAAACGGG - Intronic
1065073725 10:22054602-22054624 TGTAACAAAATACCACAGGCTGG + Intergenic
1065179854 10:23113924-23113946 TGTAACAAAGTACCACAAAATGG - Intronic
1065811963 10:29450699-29450721 TGTGACAAAGTACCACAAACTGG + Intergenic
1065959816 10:30725458-30725480 TATGACAAAGTACCACAAACTGG - Intergenic
1066136310 10:32450061-32450083 TGTAACAAAGTACCACAAAGTGG + Intronic
1066589742 10:36981540-36981562 GGTAACAAAGTACCACAAACTGG - Intergenic
1066661096 10:37738794-37738816 CATCACAAAGCACCACAGACAGG - Intergenic
1066735935 10:38479116-38479138 TGTAATAAAGTACCACAAACTGG + Intergenic
1067016561 10:42760235-42760257 GGTCACAAAGCACCCAGAGCTGG + Intergenic
1067554632 10:47260028-47260050 TGTAAGACAGCACCACAAACTGG + Intergenic
1067914094 10:50377664-50377686 TGTAACAAATAACCACAAACTGG + Intronic
1069635267 10:69921181-69921203 TGCCAGCAAGCACCAGAAGCCGG - Intronic
1069760364 10:70806449-70806471 TGTAACAAAGTGCCACAAACTGG + Intergenic
1070664670 10:78334573-78334595 TGTGACAAAACACCACAAATGGG - Intergenic
1070701238 10:78603146-78603168 TGTAACCAAGTACCACAAACTGG + Intergenic
1071093466 10:81946947-81946969 TGTGACAAAGCACCACAAACTGG + Intronic
1071177184 10:82940213-82940235 TGTAACAAAGCACCACAAACTGG + Intronic
1071473172 10:86001779-86001801 TCTAACAAAGGACCACAAACTGG + Intronic
1071482473 10:86075565-86075587 TGTAACAAAGTACCACAAATGGG - Intronic
1071605293 10:86981897-86981919 GGTCACATAGCACCCCGAGCTGG + Intronic
1071749937 10:88463495-88463517 TGTAACAAAGTACCACAGACTGG - Intronic
1071974784 10:90944452-90944474 CGTAACAAAGTACCACAAACAGG + Intergenic
1071980171 10:90997597-90997619 TGTAACAAAGTACTACAAACCGG + Intergenic
1072690471 10:97569585-97569607 TGTAACAAAATACCACATGCTGG + Intronic
1073450934 10:103608371-103608393 TGTAACAAAGTACCACACACTGG - Intronic
1073546888 10:104357009-104357031 CATAACAAAGCACCACAAACTGG + Intronic
1074259442 10:111837008-111837030 GGTCACAAAGCAACACAATTTGG + Intergenic
1074266814 10:111912581-111912603 TGTAACAAAGCACCACAAATTGG - Intergenic
1075234988 10:120719709-120719731 TGTAACAAATGACCACAAACTGG + Intergenic
1075470947 10:122688733-122688755 TGTAACAGAGCACCACCAGCTGG + Intergenic
1075669851 10:124256922-124256944 TGCAACAAAGCACCATAAACTGG - Intergenic
1075830923 10:125410080-125410102 TGTCACAGAACCCCACGAGCAGG - Intergenic
1076601239 10:131658260-131658282 TCTCACAAAGTCCCACAGGCTGG - Intergenic
1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG + Intronic
1078599037 11:12714648-12714670 TGTAACAAAGCACCATAGGCTGG + Intronic
1078634244 11:13033992-13034014 CGTAACAAAGCACCACAAATTGG - Intergenic
1078990958 11:16645851-16645873 TGTAACAAAGTACCACAAACTGG - Intronic
1079103518 11:17556379-17556401 TTTCACAAAGGACCACAGTCTGG - Intronic
1079237990 11:18703120-18703142 TGCCACACAGGCCCACAAGCAGG - Exonic
1079323052 11:19468274-19468296 TGTAACAAAGTGCCACAAACTGG + Intronic
1081138655 11:39470729-39470751 TGCCAGAAAGCACCAAAAGCTGG - Intergenic
1081188726 11:40077628-40077650 TGTAACAAATTACCACAAACTGG - Intergenic
1081274743 11:41134544-41134566 TGTAACAAAGCACCACAGACTGG + Intronic
1081373306 11:42330380-42330402 TGTAACAAAGCACCACAAAATGG - Intergenic
1081430005 11:42966641-42966663 TGTAACAAATGACCACAAACTGG + Intergenic
1081443512 11:43106715-43106737 TGTAACAAAGTACCATAAACTGG - Intergenic
1081461580 11:43277178-43277200 TGTCACCAAGTGCCACAAGCTGG - Intergenic
1081741405 11:45443505-45443527 TGTGACAAATTATCACAAGCTGG + Intergenic
1082637555 11:55614993-55615015 CATAACAAAGCACCACAAACTGG - Intergenic
1082762173 11:57137933-57137955 TCTAACAAAGTACCACAAACTGG + Intergenic
1083064946 11:59914854-59914876 TGTAACAAAGCACCACAAATTGG + Intergenic
1083355884 11:62065786-62065808 CGTCACAAAGTGCCACAAGCTGG + Intergenic
1083473848 11:62902845-62902867 CGTAACAAAGTACCACAAACTGG - Intergenic
1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG + Intronic
1084073705 11:66755630-66755652 TGTAACAAAGTACCACAAACTGG + Intronic
1084196472 11:67525622-67525644 TGTCACATAGCCCCAGAAGCTGG - Intergenic
1084234499 11:67778096-67778118 TATAACAAGGTACCACAAGCTGG + Intergenic
1084330696 11:68428341-68428363 TGTAACAAATGACCACAAACTGG + Intronic
1084468693 11:69342650-69342672 TGTAACAAAGCACTGCAGGCTGG - Intronic
1084673740 11:70622442-70622464 TGTTACAAAGCAACACAAACTGG + Intronic
1084715198 11:70869249-70869271 CGTCATAAAGCACCACAGACAGG - Intronic
1085922904 11:80980423-80980445 TGAAACAAAGCATCACAAGCTGG - Intergenic
1086299243 11:85407613-85407635 AGTCACGAAGCAGCACAAGCAGG + Intronic
1086916508 11:92535424-92535446 TGTAACCAAGCACCACAAACTGG - Intronic
1086999489 11:93400181-93400203 TGTAACAAAGTACCAAAAGCTGG + Intronic
1089187213 11:116627426-116627448 TGTAACAAAGTACCACAAACTGG + Intergenic
1090036231 11:123251980-123252002 TGTAACAGAGTACCACAAACTGG - Intergenic
1091017564 11:132066472-132066494 TGTAACAAATTACCACAAACTGG + Intronic
1091097095 11:132834405-132834427 TGTCACAAAGCACCATCAACTGG + Intronic
1091824268 12:3498807-3498829 TGTAATAAAGTACCACAAACTGG + Intronic
1092048896 12:5454052-5454074 CGTAACAAAGCACCACAAATTGG + Intronic
1092726067 12:11486737-11486759 TGTCAGACAGCACCACCTGCTGG + Intronic
1092732644 12:11548463-11548485 TGTAATAAATGACCACAAGCTGG - Intergenic
1092767080 12:11862404-11862426 TGTAACAAAGTACCCCAAACGGG + Intronic
1093338182 12:17935885-17935907 TGTAACAAAGTAGCACAAACTGG + Intergenic
1093424203 12:19010191-19010213 TGTAACAAAGTACCAGAAACTGG + Intergenic
1093763592 12:22937684-22937706 TGTAACAGAGTACCACAAACTGG - Intergenic
1093974874 12:25410588-25410610 TGTAACAAAGTACCACAAACTGG - Intronic
1094318684 12:29160580-29160602 TGTAACAAAGTACCACAAACTGG + Intronic
1094616827 12:32043464-32043486 CATAACAAAGCACCACAAACTGG + Intergenic
1095529866 12:43174257-43174279 TGTGACAGAATACCACAAGCTGG - Intergenic
1096415347 12:51407809-51407831 TATAACAAAGTACCACAAACTGG + Intronic
1098131781 12:67358710-67358732 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1098169431 12:67731732-67731754 TGTAAGAAATCACCACAAACTGG + Intergenic
1098338911 12:69431747-69431769 TGTAACTAAGTACCACAAACTGG - Intergenic
1099161034 12:79242135-79242157 TGTAACAAATGACCACAAACTGG - Intronic
1099648426 12:85391951-85391973 TATAACAAAGCACCACAGACTGG + Intergenic
1099925277 12:89009327-89009349 TCTCACAAAGCAACACAATGAGG - Intergenic
1100216993 12:92461362-92461384 TGTCACAAAGTACCATAGACTGG + Intergenic
1100297363 12:93275314-93275336 TGTAACAAAGTACCACACACTGG - Intergenic
1100324886 12:93531421-93531443 TGTAACAAATTACCACAAACCGG + Intergenic
1100605609 12:96149746-96149768 TGCAACAAAGCACCACAGACTGG + Intergenic
1101039196 12:100736985-100737007 TGTGACAAAGTACCACAAACTGG - Intronic
1101257289 12:102990925-102990947 TGTAACAAAGTACCACAGACAGG + Intergenic
1101328101 12:103734694-103734716 CATCACAAATTACCACAAGCTGG + Intronic
1101395107 12:104340404-104340426 TGTAACAAAGTACCACAAACTGG + Intronic
1101505328 12:105341042-105341064 TGTAACAAATTACCACAAACTGG - Intronic
1101511015 12:105392399-105392421 TGTAACAAAGCACCACAAAATGG - Intronic
1101558160 12:105830422-105830444 TGTAACAAAGTACCACAAATGGG + Intergenic
1101653396 12:106697494-106697516 TGTAACAAATTACCACAAACTGG + Intronic
1101692596 12:107095467-107095489 TGTAAAAAAGCACCACAAATTGG - Intergenic
1101702863 12:107191755-107191777 TGTAACAAATTATCACAAGCTGG + Intergenic
1101911974 12:108866834-108866856 TGTAACAAAGTGCCACAAACTGG - Intronic
1101992646 12:109499883-109499905 AGAAACAAAACACCACAAGCTGG - Intronic
1101998449 12:109541636-109541658 TGCAACAAATCACAACAAGCCGG + Intergenic
1102783175 12:115583249-115583271 TGTCTCTAAGCACCACACACAGG + Intergenic
1103033912 12:117641014-117641036 TGTAACAAAGTACCACAAACTGG + Intronic
1103041366 12:117698204-117698226 TGTAACAAAGTACCATAAACTGG - Intronic
1103061847 12:117864541-117864563 TGTAACAAAGTACCACAAGTTGG + Intronic
1103171470 12:118824177-118824199 TATAACAAAGTACCACAAACTGG - Intergenic
1103799556 12:123528724-123528746 TGTAACAAATCAACACAAACTGG - Intronic
1103859062 12:123997336-123997358 TGTAACAAAGTACCACAAGCTGG + Intronic
1104077102 12:125399659-125399681 TGTAACAAATTACCACAAACTGG - Intronic
1104591640 12:130088618-130088640 CGTCAAAAAGGACCACAGGCTGG + Intergenic
1104598556 12:130136899-130136921 TGTAACTGAGGACCACAAGCTGG - Intergenic
1104607721 12:130202311-130202333 TATAACAAAACACCACAAACTGG + Intergenic
1104916326 12:132266701-132266723 TGTAACAAGGAGCCACAAGCAGG - Intronic
1105047804 12:133020665-133020687 CGTAACAAAGAACCACAAACTGG + Exonic
1105249963 13:18689562-18689584 TGTAACAAAGTACCACAAACCGG - Intergenic
1105968133 13:25403317-25403339 TGTAACAAAATACCACAGGCTGG - Intronic
1106003121 13:25743393-25743415 TGTAACCAAGCACCATAAACTGG - Intronic
1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG + Intergenic
1106427968 13:29651354-29651376 TGTAACAAAGTACCACACACTGG + Intergenic
1106431366 13:29683687-29683709 TGTGACAAAGTACCACGAGTAGG + Intergenic
1106531527 13:30597473-30597495 TGTAACAAAGTACCACAAATTGG - Intronic
1106650632 13:31686435-31686457 CATCACAAAGTACCACAAACTGG + Intergenic
1106882202 13:34143828-34143850 TGTAACAAAGTACCTCCAGCAGG - Intergenic
1106907077 13:34420420-34420442 TGTCACAAAGCACCACAAACTGG + Intergenic
1107040564 13:35943397-35943419 TATAACAAAGTACCACAAACTGG - Intronic
1107451890 13:40517294-40517316 TGTAACAAAGTACAACAAACTGG - Intergenic
1107677151 13:42809210-42809232 TGTAACAAAACACCAAAAACTGG - Intergenic
1107759880 13:43666678-43666700 CTTAACAAAGCACCACAAACTGG - Intronic
1107881610 13:44837004-44837026 TGTAACAAAACACCATAAACTGG + Intergenic
1108458677 13:50643105-50643127 TGTAACAAAGTACCACAAATTGG - Intronic
1108505349 13:51107933-51107955 TGTAACAAAGCACCACAAACTGG + Intergenic
1108716267 13:53081103-53081125 TGTAACAAAGCACCACAAACAGG - Intergenic
1108825216 13:54405550-54405572 TGTAACAAATTACCACAAACTGG + Intergenic
1109202454 13:59446022-59446044 TGTCACATAGTACCACAAGCTGG + Intergenic
1109804542 13:67421205-67421227 TGTAACAAAGTTCCACAAACTGG - Intergenic
1109821084 13:67655772-67655794 TGTCAGAAAGCACTGCAAACAGG - Intergenic
1110098385 13:71561650-71561672 TGTAACAAAGAACCAGAAACTGG - Intronic
1110156261 13:72320526-72320548 TGTCAGAAAACAGCAGAAGCAGG - Intergenic
1110161867 13:72388050-72388072 TGTAACAAAGTGCCACAAACTGG - Intergenic
1110379566 13:74834964-74834986 TGCAACAAAGCACCACAGACTGG + Intergenic
1110413926 13:75231981-75232003 TATAACAAAGCACTACAAACTGG - Intergenic
1110736972 13:78948466-78948488 AGTCACAAAGCAACAGATGCTGG - Intergenic
1111099170 13:83558906-83558928 TTTGACAAAGTACCACAAACTGG - Intergenic
1111360929 13:87175332-87175354 TGTAACAAAGTTCCACAAACTGG + Intergenic
1111622946 13:90747547-90747569 TGTAACAAAGTACCACAAACTGG + Intergenic
1111927712 13:94480880-94480902 TGTAACAAATGACCACAAACTGG + Intergenic
1112143414 13:96671494-96671516 TGTAACGAAGCACCACAGACTGG + Intronic
1112300582 13:98226085-98226107 TATAACAAAGTACCACAAACTGG + Intronic
1112865682 13:103894054-103894076 TGTAACAAAGCACCACAAACTGG + Intergenic
1113081470 13:106524800-106524822 TATTAGAAAGCACCAAAAGCAGG + Intronic
1113093809 13:106641707-106641729 CATAACAAAGAACCACAAGCTGG - Intergenic
1113223692 13:108134953-108134975 TGTAACAAAGTACCACAAACTGG - Intergenic
1113360166 13:109623198-109623220 TGTCACAAATGACCACAAACTGG - Intergenic
1113594938 13:111524525-111524547 TGTGACAAAGTATCACCAGCTGG - Intergenic
1113613543 13:111664919-111664941 TGTGGCAAAGCACCACACACTGG - Intronic
1113615136 13:111675235-111675257 TGTAACAAAGTGCCACAAACAGG + Intergenic
1113620603 13:111760148-111760170 TGTAACAAAGTGCCACAAACAGG + Intergenic
1114666759 14:24382049-24382071 TGAACCAAAGCACCACAAACCGG + Intergenic
1114843044 14:26288570-26288592 AGTCACAAAGTAACACATGCTGG - Intergenic
1116030295 14:39562870-39562892 TGTAACAAAACACCACAAAATGG - Intergenic
1117444071 14:55787057-55787079 TGTAACAGAGTACCACAAACTGG + Intergenic
1118500992 14:66362528-66362550 TATAACAAAACACCACAAACTGG + Intergenic
1118941112 14:70339101-70339123 TGTTACAAAGCACAACAGGCAGG + Intronic
1119456492 14:74760451-74760473 TGTAACAAAGCACCACAAACTGG + Intergenic
1119863580 14:77954883-77954905 TATCACAAAGTACCACAGACTGG + Intergenic
1119993338 14:79224956-79224978 TGTAACAAAGAACCACAAACTGG - Intronic
1120092075 14:80343634-80343656 TGTAACAAAGTGCCACAAACTGG + Intronic
1120132016 14:80819039-80819061 TTTAACAAAGCACCACAGACTGG + Intronic
1120148534 14:81006227-81006249 TGTCACAAAGCCCCACAGACTGG + Intronic
1120179569 14:81329657-81329679 TGTCACAAATTACCGCAAACTGG - Intronic
1120192576 14:81452579-81452601 TATAACAAAGTACCACAAACTGG - Intergenic
1120418798 14:84255577-84255599 TTTAACAAAGGACCACAAACTGG - Intergenic
1120424871 14:84334480-84334502 TGTCAGCAACCACCAAAAGCTGG - Intergenic
1120438757 14:84510074-84510096 TGTAACAAATCACTACAAACTGG + Intergenic
1120609353 14:86621449-86621471 AGTAACAAAGCACCACAAATTGG + Intergenic
1120673046 14:87386536-87386558 TGTAAGAAATTACCACAAGCTGG - Intergenic
1120721321 14:87892367-87892389 TGCAACAAAGCACCACAAACTGG - Intronic
1120877994 14:89392384-89392406 TGTAACCAAGTGCCACAAGCCGG + Intronic
1120964816 14:90158061-90158083 TGGGACCAAGCACCACCAGCAGG - Intronic
1120991382 14:90380463-90380485 TGTAACAAAATACCACAGGCTGG - Intergenic
1121219110 14:92272537-92272559 CATCACAAAACCCCACAAGCTGG + Intergenic
1121327696 14:93031103-93031125 TGTCACAAAGGGCCACAAACTGG - Intronic
1121349487 14:93162053-93162075 TGTCACAAAGCGCCCCGAACTGG - Intergenic
1121418363 14:93794945-93794967 TGTAACAAAACACCCCAAGCTGG - Intergenic
1121482954 14:94292422-94292444 TCTAACAAAACACCACAGGCTGG - Intronic
1121567662 14:94922907-94922929 CATAACAAAGCACCACAAACTGG + Intergenic
1121800383 14:96769469-96769491 TGTCACAAAGCACCACAAACTGG + Intergenic
1121974445 14:98389954-98389976 TGTAACCAAGCACTACAAACTGG + Intergenic
1122595748 14:102889807-102889829 AGTCTCAAAGCACCACCAACTGG - Intronic
1122969026 14:105144968-105144990 GGTCGCAAAGCAACACCAGCAGG + Exonic
1123019576 14:105391419-105391441 TGTCACAAAGCCCCACATCAAGG + Intronic
1123792957 15:23741189-23741211 TGTAACAGAGCACCACAGACTGG + Intergenic
1123984708 15:25635141-25635163 TGTAACAGAGCACCACAGACTGG + Intergenic
1124221804 15:27855924-27855946 TGTCACAAAGCACCACGAGCTGG + Intronic
1124606088 15:31171306-31171328 TGTGACTAAGGACCACAGGCTGG + Intergenic
1125647907 15:41288323-41288345 TGTAACAAAGCACCACAAATTGG + Intergenic
1125655223 15:41351216-41351238 TGTGACAAAGCACCACAACTGGG + Intronic
1125832162 15:42724679-42724701 TGTCACTAAAGACCACAACCTGG + Intronic
1127287294 15:57543006-57543028 TGTAACAAAGTAACACAACCTGG + Intronic
1127293428 15:57590443-57590465 TCTCACAATGCCCCACAAGGTGG - Intergenic
1127791969 15:62406130-62406152 TGTAACAAAGTACCACATACTGG + Intronic
1127991439 15:64121229-64121251 TGTAGCAAAGTACCACAAACTGG + Intronic
1128243271 15:66115974-66115996 TATTACAAAGTACCACAGGCTGG - Intronic
1128356934 15:66934803-66934825 TGTAACAAATCGCCACAAACTGG - Intergenic
1128660902 15:69500314-69500336 TGTAACTAAGTACCACTAGCTGG + Intergenic
1128798730 15:70483272-70483294 AGTCACATGGCACCACCAGCTGG - Intergenic
1129136370 15:73555900-73555922 TGTGACAAATCATCAGAAGCTGG + Intronic
1129612974 15:77075026-77075048 AGGCACAAACCACCACAAGCAGG - Intronic
1129775766 15:78235314-78235336 TGTAACAAAGTTCCACAAACTGG + Intronic
1129923826 15:79344297-79344319 TGTAACAAATGACCACAAACTGG + Intronic
1130660540 15:85828510-85828532 TGTAACAAATTACCACAAACTGG + Intergenic
1130676914 15:85960972-85960994 TATAACAAAGTACCACAAGCTGG - Intergenic
1130823948 15:87524631-87524653 TGTAATAAAGTACCACAAACTGG - Intergenic
1130873815 15:87994631-87994653 TGTAACAAAGTGCCACAAACTGG - Intronic
1130949491 15:88574164-88574186 TATAACAAAACACCATAAGCTGG - Intergenic
1131369166 15:91865451-91865473 TGTAACAAATTACCACAAACTGG + Intronic
1131586869 15:93704719-93704741 TGTAACAACGTACCACAAACTGG - Intergenic
1131673295 15:94645269-94645291 TGTAACAAATGACCACAACCGGG - Intergenic
1131958758 15:97765974-97765996 CGTTACAAAGTACCACAAACTGG - Intergenic
1132018479 15:98339587-98339609 TATAACAAAGTACCCCAAGCTGG + Intergenic
1132329273 15:101000458-101000480 TGTAACAAAGCACCCAAAACTGG + Intronic
1133208216 16:4246898-4246920 TATCACAAAGCACGAAGAGCAGG + Intergenic
1133401871 16:5493996-5494018 CTTCACAAAGCCCCACAAGAAGG - Intergenic
1133533272 16:6675226-6675248 TGCAACAAATCACCACAACCTGG - Intronic
1134299969 16:12981996-12982018 TGTAACAAAGTACCACAGACTGG - Intronic
1134449959 16:14357343-14357365 TGTAAAAAATCACCACAAACAGG - Intergenic
1134855051 16:17511526-17511548 TGTAACAAAGTCCCACAAGCTGG + Intergenic
1135075092 16:19386351-19386373 TGTCACAAGACACCACTAGAAGG - Intergenic
1135167710 16:20155497-20155519 TGTAACAAACAACCACAAACTGG + Intergenic
1135622217 16:23965832-23965854 TGCCACAAAGCAGCTGAAGCTGG - Intronic
1135834931 16:25816652-25816674 TGTAACAAAGTACCCCAAACTGG + Intronic
1136243792 16:28961440-28961462 TGTAACAAAGTACCACAAGTTGG + Intronic
1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG + Intergenic
1136811985 16:33184396-33184418 TGAAACACAGCACCACAAGGAGG - Intergenic
1136818461 16:33294476-33294498 TGAAACACAGCACCACAAGGAGG - Intronic
1136825025 16:33351009-33351031 TGAAACACAGCACCACAAGGAGG - Intergenic
1136830091 16:33449780-33449802 TGAAACACAGCACCACAAGGAGG - Intergenic
1137454367 16:48607124-48607146 TATCACAAAGATCAACAAGCAGG + Intronic
1137952887 16:52800300-52800322 TGTAACAAAGTACCACAGGCCGG - Intergenic
1138853861 16:60663537-60663559 TGTTAAAAAGCTCCACAAACTGG - Intergenic
1139148670 16:64352881-64352903 TATAACAAAACACCACAAACTGG - Intergenic
1139418450 16:66832865-66832887 CGTAACAAAGAACCACAAACTGG + Intronic
1139999245 16:71009985-71010007 TGTAACAGGTCACCACAAGCTGG - Intronic
1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG + Intergenic
1140764541 16:78145030-78145052 TGTAACAAAGCACCACAAATTGG + Intronic
1140828545 16:78729706-78729728 TGTAACAAATTACCACAAACTGG - Intronic
1140968501 16:79990480-79990502 TGTAACAAAGTACCAAAAACTGG + Intergenic
1141133011 16:81447716-81447738 CGTCACCAAGCACTACAGGCAGG + Intronic
1141616822 16:85214608-85214630 TGTGACAAAGAACCACCATCTGG - Intergenic
1141650688 16:85391368-85391390 CGTAACAAAGTACCACAAACTGG + Intergenic
1141863480 16:86733870-86733892 TGTAACAAATCACCTCAAACTGG + Intergenic
1142118057 16:88370663-88370685 TGTCACAAATGACCGCAAACTGG + Intergenic
1202990563 16_KI270728v1_random:7366-7388 TGAAACACAGCACCACAAGGAGG - Intergenic
1143364736 17:6399063-6399085 TGTAACGAAGTATCACAAGCTGG - Intronic
1143535584 17:7537191-7537213 TGTGTCAAAGCACCATATGCTGG - Intergenic
1143972638 17:10806515-10806537 TGTAACAAAGCACCACAGCCAGG + Intergenic
1143993016 17:10982764-10982786 TGTAACAAAGTACCACAGGCTGG + Intergenic
1144290776 17:13824191-13824213 TGCAACAAAGAACCACAAACTGG + Intergenic
1144336004 17:14269483-14269505 TGTAACAAATTACCACAAACTGG + Intergenic
1144464199 17:15483635-15483657 TATCACAAAGTACCGCAAGCTGG - Intronic
1144750346 17:17644260-17644282 TGTAACAAAGCATCACAGACTGG - Intergenic
1145095847 17:20025327-20025349 TGGAACAAAGTACCACAAACTGG - Intronic
1146206411 17:30908703-30908725 TGTAACAAATGACCACAAACTGG - Intronic
1146852795 17:36237914-36237936 TGCAACAAAGTACCACAAACTGG - Intronic
1146868706 17:36361806-36361828 TGCAACAAAGTACCACAAACTGG - Intronic
1147083106 17:38041954-38041976 TGCAACAAAGTACCACAAACTGG - Intronic
1147099049 17:38165927-38165949 TGCAACAAAGTACCACAAACTGG - Intergenic
1148390035 17:47265304-47265326 TGTAACAAAGCACCACAAACTGG + Intronic
1148481675 17:47963609-47963631 TGTAACAAATCACCACAAACTGG - Intergenic
1148587023 17:48788190-48788212 TGTCATAATGCACTAAAAGCTGG + Intronic
1149207134 17:54261299-54261321 TCTGACAAAGTACCACAAACTGG - Intergenic
1149838582 17:59937387-59937409 TGCAACAAAGTACCACAAACCGG + Intronic
1149881487 17:60296603-60296625 CATAACAAAGCACCACAAACTGG - Intronic
1150080585 17:62234970-62234992 TGCAACAAAGTACCACAAACTGG - Intergenic
1150165025 17:62933145-62933167 TGTAACAAGGCACCACAAACTGG - Intergenic
1150318809 17:64192562-64192584 TGGGACAAAATACCACAAGCTGG - Intronic
1150354027 17:64468105-64468127 TGCCACAAATGACCACAAGTTGG + Intronic
1150506560 17:65704321-65704343 TGTAACAAAGAACCAAAAACTGG - Intronic
1150710830 17:67529617-67529639 TGTAACAAAGTGCCACAAACTGG + Intronic
1150841043 17:68605595-68605617 TGTAACAAAGTGCCACAAGCTGG - Intergenic
1150915015 17:69428173-69428195 TGTAACAAAGTACCACAAATTGG + Intronic
1152009354 17:77701602-77701624 TGTAACAAAGCATCACAAACTGG + Intergenic
1152390353 17:80000584-80000606 TGTGACAAAGGACCACAAACCGG - Intronic
1152478028 17:80531086-80531108 TGTAACAAAGTACCACAAACTGG - Intergenic
1152853598 17:82650965-82650987 TGGAACAAAGCCCCACAGGCTGG - Intergenic
1153642123 18:7166201-7166223 CGTAACAAAGCACCACCAGCTGG - Intergenic
1153930928 18:9879018-9879040 TGTAACAAACCACCACAAATGGG + Intergenic
1154438863 18:14369334-14369356 TGTAACAAAGTACCACAAACTGG + Intergenic
1155528742 18:26744255-26744277 TGCCAGAAAACACCAGAAGCTGG - Intergenic
1156260287 18:35439829-35439851 TGTAACAAAGCACCACAAACTGG - Intergenic
1156488221 18:37480118-37480140 TGCAACAAAGCACCACAAATTGG - Intronic
1157084392 18:44564123-44564145 TGTAACAGAGTACCACAAACTGG - Intergenic
1157537166 18:48468388-48468410 TGTAACAAAGCACCACAAACTGG - Intergenic
1157714335 18:49872878-49872900 TGAAACAAAACACCACAAACTGG - Intronic
1157883198 18:51341626-51341648 TGTGACAAAGGACCACAGACTGG - Intergenic
1158282508 18:55842890-55842912 TGTAACAAAGCAATCCAAGCAGG - Intergenic
1158322388 18:56277785-56277807 TGTTACACAGTACCACAAACTGG - Intergenic
1158415683 18:57247923-57247945 TGTAACAAAGTACCACAAACTGG + Intergenic
1158467179 18:57701244-57701266 TGACGCCCAGCACCACAAGCAGG + Exonic
1158483342 18:57842550-57842572 TGTAACAAAGTTCCACAAACTGG + Intergenic
1158625713 18:59069945-59069967 TGTGACAAAGTACCAAAAACTGG - Intergenic
1158717671 18:59894941-59894963 TGTAACAAAGTACCACAGACTGG - Intergenic
1158733683 18:60055289-60055311 TGTAACAAAATACCACAAACTGG + Intergenic
1158827114 18:61235142-61235164 CGTAACAAAGTACCACAAACTGG + Intergenic
1158847587 18:61461299-61461321 CGTAACAAAGTACCACAAGCTGG + Intronic
1159114742 18:64101325-64101347 TGTCACAGAGTTCCAGAAGCTGG + Intergenic
1159117721 18:64134959-64134981 TGTAATAAAGTACCACAAGTTGG + Intergenic
1159299039 18:66538640-66538662 TGCAACAAAACACCACAAACTGG + Intronic
1160090987 18:75826332-75826354 TGTAACAAAGCACCACAGACTGG + Intergenic
1161228596 19:3160647-3160669 CGTAACAAAGTACCACAAACTGG + Intronic
1161243909 19:3238415-3238437 TGTAACAAATGACCACAAACTGG + Intronic
1161308794 19:3582325-3582347 TGTAACAAAGCACCAAAAACTGG - Intergenic
1161806586 19:6447148-6447170 TGTAACAAAGTATCACAAACTGG - Intronic
1162831915 19:13290308-13290330 TCTCAAAAAGCATCACAAGCAGG - Intronic
1163496681 19:17650076-17650098 TGTCACAAAGTACCACAGACGGG - Intronic
1163687628 19:18720933-18720955 TGTAACAAATGACCACAAACTGG + Intronic
1163723438 19:18909275-18909297 TGTGGCAAAGCACCACAGCCCGG + Intronic
1164450367 19:28357072-28357094 TGTAACAGAGCACCACAGCCTGG + Intergenic
1164463584 19:28468952-28468974 TGTCACTTAGCACCACACGTGGG + Intergenic
1165588403 19:36943047-36943069 TGTCAAACACCACCACAAGGAGG - Intronic
1165643980 19:37417572-37417594 TGAAACAAAGTACCACAAGCTGG - Intronic
1166038278 19:40185721-40185743 TGCCATAAAGTACCACAAACTGG + Intergenic
1166845808 19:45727617-45727639 GGTCACACAGCAACAGAAGCAGG + Intronic
1167199245 19:48052752-48052774 TGTAACAAAATACCACTAGCTGG - Intronic
1167533328 19:50032654-50032676 TGTAACAAAGTACCACACACTGG + Intronic
1168477500 19:56687518-56687540 TGTAACAAAACACCACAGACTGG + Intergenic
1168503371 19:56912397-56912419 TTTCACAGGGCACCACGAGCAGG + Intergenic
1202701506 1_KI270712v1_random:168536-168558 TGTAACAAAATAGCACAAGCTGG - Intergenic
925541971 2:4976438-4976460 TATAACAAAACACCTCAAGCCGG - Intergenic
925643013 2:6005468-6005490 TGTAACAAAAAACCACAAACTGG + Intergenic
926087741 2:10030580-10030602 TGTCTCAAAACACCATAAACTGG - Intergenic
926520213 2:13901040-13901062 TATGACAAAACACCACAAACTGG - Intergenic
926613015 2:14966233-14966255 CGTTACAAAGTACCACAAACTGG - Intergenic
927492938 2:23532486-23532508 TCCCACAAAGCTCCACTAGCAGG - Intronic
927922743 2:26986012-26986034 TGTGACAAATGACCACAAACTGG - Intronic
927943684 2:27121850-27121872 TGTAAGAAAGCACTACAAACTGG - Intergenic
928191107 2:29169155-29169177 TGTGACAAAGTACCACAGACTGG + Intronic
928939976 2:36717793-36717815 TGTAACAAAACACCGCAATCTGG + Intronic
928945203 2:36765881-36765903 TGTAACAAACTACCACAAACTGG - Intronic
929761799 2:44813391-44813413 TGTCCCAAATAGCCACAAGCAGG - Intergenic
929862548 2:45692198-45692220 CATAACAAAGCACCACAAACTGG + Intronic
930103413 2:47620044-47620066 TGTAACAAAGCACCACAACTGGG - Intergenic
930579650 2:53195012-53195034 TATAACAAAACACCACAAACTGG - Intergenic
930584943 2:53257456-53257478 TGTAACAAAACACCACAGACTGG - Intergenic
930822813 2:55664180-55664202 TGTCATAAACCCCCACAAGGTGG - Intronic
931259450 2:60604523-60604545 TGTGACAAAGTACCATAAACTGG - Intergenic
931424024 2:62154490-62154512 TGTAACAAAACAACACAAACTGG + Intergenic
932297589 2:70640014-70640036 TGTAACAGAGCACCACAAACTGG + Intronic
932373058 2:71208983-71209005 TGTGACAAATTACCACAAACTGG - Intronic
932385351 2:71327370-71327392 CGTAACAAATCACCACAAGTTGG - Intronic
933401720 2:81806937-81806959 TTTCTCAAAGAACTACAAGCAGG - Intergenic
933582799 2:84146230-84146252 TGTAACAAAGTACCATAGGCTGG - Intergenic
933761343 2:85674320-85674342 TGGAACAAAGCACCACAAGCTGG - Intergenic
934172423 2:89551983-89552005 TGTAACAAAATAGCACAAGCTGG - Intergenic
934282736 2:91626335-91626357 TGTAACAAAATAGCACAAGCTGG - Intergenic
935285541 2:101560962-101560984 TGTAACAAAGCATCACAAACTGG - Intergenic
935599226 2:104905526-104905548 TGTAACAAATCACCACAAACTGG + Intergenic
936558308 2:113514923-113514945 TGTCACAAAATACCAGAAACTGG + Intergenic
936619127 2:114076712-114076734 TGCAACAAAGCACCACAAATGGG - Intergenic
936678418 2:114741943-114741965 TGGAACAAAGTACCACAAACTGG - Intronic
936968187 2:118147761-118147783 TGTAACAAACAACCACAAACTGG + Intergenic
936980836 2:118263775-118263797 TGTAACAAAGTGCCACAAACTGG - Intergenic
937528424 2:122799512-122799534 TGTAACAAAGTACCACACACTGG + Intergenic
938084027 2:128386409-128386431 TGTAACAAAGCGCCACAGGCTGG + Intergenic
938542346 2:132294712-132294734 TGTAACAAAGTACCAGAAACTGG + Intergenic
938630358 2:133160091-133160113 TGTAACAAAGTAACACAAACTGG + Intronic
939029834 2:137058949-137058971 TATAACAAAGTACCAGAAGCTGG - Intronic
939161988 2:138601684-138601706 TGCCAGAAACCACCAAAAGCTGG + Intergenic
939424265 2:142014599-142014621 TGTCACAAAGCAGTAAAACCAGG + Intronic
940259056 2:151761577-151761599 TGTCAGCAACCACCAGAAGCTGG + Intergenic
940861401 2:158773905-158773927 TGTAATAAAGTACCACAAACTGG - Intergenic
941013739 2:160331180-160331202 TGTAACACAGTACCACAACCTGG - Intronic
941165651 2:162080206-162080228 TATAACAAAGTACCACAAACTGG - Intergenic
941283164 2:163578057-163578079 TGTAACAAAGTACCATAAACTGG + Intergenic
941288808 2:163649162-163649184 TGTCAAAATACAACACAAGCAGG + Intronic
941635954 2:167934999-167935021 TGCCATAAAGTACCACAAACTGG - Intergenic
942245733 2:174006166-174006188 TGTAACAAAATACCATAAGCTGG + Intergenic
942521174 2:176805923-176805945 TGATACAAAGCATCACAAACTGG - Intergenic
943070946 2:183139880-183139902 TGTAACAAATTACCACAAACTGG - Intronic
943265933 2:185732424-185732446 TGTAACAAAGTACCACAAGCTGG - Intergenic
943489218 2:188529602-188529624 TGAAACAAAACACCACAAACTGG + Intronic
944059720 2:195559575-195559597 TGTAACAAGACACCACAAACTGG - Intergenic
944315036 2:198275648-198275670 TGTAACAGAGTACCACAAACTGG + Intronic
944388253 2:199188592-199188614 TGCAACAAAGTACCACAGGCTGG + Intergenic
944451397 2:199846731-199846753 AGTCACAAACCACCAAAAGCTGG - Intronic
944542502 2:200767123-200767145 TCTTACAAAGTACCACAAACTGG + Intergenic
944631382 2:201628884-201628906 TGTAACAAAGTACCACACACTGG - Intronic
944677830 2:202048940-202048962 TGTAACAAACTACCACAAACTGG - Intergenic
944922960 2:204434578-204434600 TGTAACAAATCACCACAAACTGG - Intergenic
945091950 2:206183946-206183968 TGTAACAAAGCAACAGAAACTGG + Intronic
945124225 2:206490300-206490322 TGCCACAAAGTACCACAGACTGG - Intronic
946448977 2:219763656-219763678 TGTAAAAAAGCACCACAGGGTGG + Intergenic
946460828 2:219867104-219867126 TGTAACAAAGTACCACAAACTGG + Intergenic
946701482 2:222418711-222418733 TATGACAAAGTACCACAAACTGG + Intergenic
946867518 2:224055770-224055792 TGTAACAAATTACCACAAACTGG + Intergenic
947078219 2:226367097-226367119 TGTAACAAAGCACCACAGACTGG - Intergenic
947239154 2:227975688-227975710 TGTCACAAACAACAACATGCAGG - Intergenic
947265369 2:228273675-228273697 TGTAACAAAGTACCACAAATTGG + Intergenic
947321723 2:228926542-228926564 TGTAACAAAGTACCACAGACTGG - Intronic
947324913 2:228963492-228963514 TGTAACAAAGCACTACAAACTGG - Intronic
947803272 2:232945726-232945748 TGGAACAAAGCACCACAAACTGG - Intronic
947973239 2:234342261-234342283 TGTAACAAATCGCCACAAACTGG - Intergenic
948111739 2:235461770-235461792 TCTCACAAAGCCCCGCAAACTGG - Intergenic
948147906 2:235722219-235722241 GGTAACAAAGTACCACAAACTGG + Intronic
948183515 2:236001326-236001348 TGCCACAATGCACCGCACGCTGG - Intronic
948260967 2:236604158-236604180 TGTAACAAAGTGCCCCAAGCTGG + Intergenic
948279379 2:236734791-236734813 TGTAACAAAGTACCACAAAGGGG - Intergenic
948287804 2:236800631-236800653 TGTAACAAATGGCCACAAGCTGG + Intergenic
948396161 2:237646848-237646870 TGTAACAAAACACCACAGACTGG - Intronic
948719326 2:239888535-239888557 TGTAACAAAGTACCACAGGCTGG - Intergenic
948832442 2:240604727-240604749 TGTAACAAAGCACCATAGCCTGG + Intronic
948859195 2:240744761-240744783 TGTCACAAAGCACCACAGGTGGG - Intronic
949084850 2:242143837-242143859 TGTAATAAAGTACCACAAACTGG + Intergenic
1169111826 20:3039000-3039022 TGTAGCAAAGCACCACAGACTGG - Intronic
1169818688 20:9685652-9685674 TATAACAAAGTACCACAAACTGG - Intronic
1169895772 20:10503626-10503648 TGTAACAAACAACCACAAACTGG + Intronic
1170018901 20:11813834-11813856 TGTAACAAAGCGCCACAAACTGG - Intergenic
1170054505 20:12185539-12185561 TGTAACAAAATACCACAAACTGG - Intergenic
1170642336 20:18165596-18165618 AGGAACAAAGCACCACAAACTGG - Intronic
1171006314 20:21468615-21468637 TGCCAAGGAGCACCACAAGCTGG - Intergenic
1171871224 20:30527555-30527577 TGTAACAAAGTACCAGAAACTGG + Intergenic
1172762833 20:37334026-37334048 TGTCACAGAGCATCCCCAGCAGG + Intergenic
1173202768 20:40966368-40966390 CATCAAAAAGCACCACTAGCAGG + Intergenic
1173531913 20:43776286-43776308 GGTAACAAAGTGCCACAAGCGGG + Intergenic
1173554080 20:43953251-43953273 TGTCACAAATCACCATAAACAGG - Intronic
1173956175 20:47034695-47034717 CATAACAAAGCACCACAATCTGG + Intronic
1174456146 20:50649998-50650020 TGTAACAGAGAACCATAAGCTGG + Intronic
1174466551 20:50722156-50722178 GTTCACAAAGTACCACACGCTGG - Intergenic
1174505698 20:51016107-51016129 TGTCACAAATTACCACAAACTGG - Intronic
1174958417 20:55127484-55127506 TGTAACAAAGTATCACAAACTGG - Intergenic
1175026819 20:55911173-55911195 TGTAACAAAACACCACAAACGGG - Intergenic
1175115061 20:56676325-56676347 CCTAACAAATCACCACAAGCTGG - Intergenic
1175163183 20:57023842-57023864 TGTAACAAATGACCACAAACTGG - Intergenic
1175214616 20:57385281-57385303 TGTCACAAACTACCACAGGCCGG - Intergenic
1175669906 20:60893126-60893148 TGTAACAAATGACCACAAACTGG - Intergenic
1175850019 20:62085274-62085296 TGTGACAAATCACCACAAGCTGG - Intergenic
1176430369 21:6571644-6571666 TGTGACAAACGACCACAAGCTGG + Intergenic
1176456819 21:6920098-6920120 TGTAACAAAGTACCACAAACTGG - Intergenic
1176834992 21:13785158-13785180 TGTAACAAAGTACCACAAACTGG - Intergenic
1177107458 21:16977972-16977994 CATAACAAAGTACCACAAGCAGG + Intergenic
1177586154 21:23098567-23098589 TTTCACAAAGCACCAAATGAAGG + Intergenic
1177882894 21:26715516-26715538 TGTAACAATGTACCACAAACTGG - Intergenic
1178201607 21:30413718-30413740 AGTCAAAAAGCATCACATGCTGG + Intronic
1178234259 21:30823162-30823184 TGTCATAAAACAGCACTAGCGGG - Intergenic
1178376841 21:32074215-32074237 CGTGACAAAACACCACAGGCCGG + Intergenic
1178419875 21:32434868-32434890 TATAACAAGGTACCACAAGCTGG - Intronic
1178546349 21:33495986-33496008 TGTGACAAAGCACCACAGACTGG - Intergenic
1178757267 21:35363620-35363642 TGTAACAAAGCACCACAAACTGG - Intronic
1178883970 21:36470601-36470623 CATGACAAAGCACCACAACCTGG - Intronic
1178887406 21:36494830-36494852 TGTAACAAAGCTCCACAGACAGG - Intronic
1178911039 21:36673950-36673972 CGTAACAAATCACCACAAACTGG - Intergenic
1178940506 21:36901454-36901476 TGTCACAAAGGACTACAAACCGG + Intronic
1179047695 21:37861196-37861218 TGTAACAAAGTACCACAAACTGG + Intronic
1179173007 21:38987536-38987558 CATAACAAAGCACCACAAACGGG + Intergenic
1179186580 21:39089620-39089642 TGTAACAAACCACCACAACCTGG - Intergenic
1179318665 21:40269542-40269564 TGTAACAAAGTTCCACAAACTGG + Intronic
1179408437 21:41143885-41143907 CATAACAAAGCACCACAAGCTGG + Intergenic
1179513760 21:41892405-41892427 TGTATCAAAGTACCACAAACTGG - Intronic
1179606804 21:42521860-42521882 TGTAACATGGTACCACAAGCTGG + Intronic
1179639085 21:42735399-42735421 CCTCACAAAGCACCACAGACTGG + Intronic
1179705763 21:43179106-43179128 TGTGACAAACGACCACAAGCTGG + Intergenic
1179713053 21:43274047-43274069 TGCCACAAAACACCACATGCAGG - Intergenic
1179728362 21:43353576-43353598 TTGCACAAAGCACCACAGACGGG - Intergenic
1179802008 21:43815470-43815492 CGTGACAAAGGACCACAGGCTGG + Intergenic
1179907591 21:44432145-44432167 TGTAACTAAGTACCACAAACTGG + Intronic
1181284751 22:21743790-21743812 TGTAACAAAGTACCACAGACTGG - Intergenic
1181490701 22:23259174-23259196 TGTAACAAAGCATCACAGACTGG + Intronic
1182012212 22:27010377-27010399 TGTAACAAAGTACCATAAACAGG + Intergenic
1182192234 22:28473987-28474009 TGTAACAAAGTACCACAAACTGG - Intronic
1182606025 22:31504589-31504611 TGTAACAAAGTACCACAAACCGG + Intronic
1182626425 22:31650060-31650082 TGTAACAAAGCAACACAAACTGG - Intronic
1182782051 22:32875879-32875901 TATAACAAAGCACCACAGGTTGG - Intronic
1183327271 22:37201068-37201090 TTTAACAAAGCACCACATACTGG + Intergenic
1184428839 22:44429188-44429210 TGTCACAAAACATCACAAAGTGG - Intergenic
1184989943 22:48160683-48160705 TGTAACAAAACACCACAAACTGG + Intergenic
1185176912 22:49333091-49333113 TGGAACAAAGCACCATACGCTGG + Intergenic
1185187898 22:49413827-49413849 TGTAACAGAGCACCGCAGGCGGG + Intergenic
1185206014 22:49539199-49539221 AGTGACAAAGCACCACAGGCCGG + Intronic
1185226926 22:49658462-49658484 CGTGACAAAGGACCACAAACTGG + Intergenic
1185322209 22:50206824-50206846 TGTCTCAAAGCACCAGCAGGGGG + Intronic
949285054 3:2392819-2392841 TGTAACAAAGTACCACAAACTGG + Intronic
949523558 3:4879907-4879929 TGTGGCAAAGCAACAAAAGCAGG - Intronic
949549255 3:5098616-5098638 TGTCACGATGCACCACAATCTGG - Intergenic
949767340 3:7541801-7541823 TGTCACACAGTACCACAAATTGG + Intronic
950554686 3:13688282-13688304 TATCACAAAGAACCACCAACAGG + Intergenic
950821035 3:15758754-15758776 TGTAACAAAGTACTACAAACTGG - Intronic
951201836 3:19883960-19883982 TGTATCAAAGTACCACAAACTGG - Intronic
951279998 3:20736448-20736470 TTCCACAAAGCTCCAGAAGCTGG + Intergenic
951429754 3:22592802-22592824 TGTAACAGATTACCACAAGCTGG + Intergenic
951911867 3:27758852-27758874 TATAACAAAGTACCACAAACTGG - Intergenic
952086357 3:29826525-29826547 TGTAACAAACTACCACAAACTGG + Intronic
952218548 3:31301695-31301717 CGTAACAAAATACCACAAGCTGG + Intergenic
952568940 3:34690484-34690506 TGTAACAAAGTACCACAGACTGG - Intergenic
952872786 3:37916732-37916754 TATATCAAAGTACCACAAGCAGG - Intronic
953494198 3:43372359-43372381 TGTCTCAAGGCAGCCCAAGCAGG + Intronic
955064976 3:55526297-55526319 TGTAACAAAGTACCACAAACTGG - Intronic
955289759 3:57680600-57680622 TCTCACAAAATACCACAAACTGG - Intronic
955888810 3:63628718-63628740 TGTAACAAAATACCACACGCTGG - Intergenic
956236519 3:67078234-67078256 TGTCACAAAATACCACAGACTGG - Intergenic
956534373 3:70259692-70259714 TGTAACAAAGTGCCACAAACTGG + Intergenic
956702501 3:71970850-71970872 TGTAACAAAGGACCACAAGTTGG - Intergenic
956717369 3:72090140-72090162 TGTGACAAAGGACCACAAACTGG + Intergenic
956752387 3:72353648-72353670 CGTAACAAAGTACCACAAACTGG - Intergenic
956944018 3:74198156-74198178 TGTAACAAAGTGCCACAAGCTGG - Intergenic
957300105 3:78381112-78381134 TGTAACAAAATACCACATGCTGG + Intergenic
957368080 3:79252581-79252603 TGTAACAAATTACCACAAACTGG - Intronic
958552343 3:95632436-95632458 TGTAACAAAGTAGCACAAGCTGG - Intergenic
959830311 3:110853770-110853792 CGTAACAAAGTACCACAACCTGG - Intergenic
960235479 3:115277158-115277180 TGTAACAAAGTACCACAAACTGG + Intergenic
960236739 3:115292025-115292047 TGTCATAAATTACCACAAACTGG - Intergenic
960851559 3:122060039-122060061 GGTAACAAAGTACCACAAACTGG - Intronic
961065006 3:123867731-123867753 TGTAACAAAGTACCACAGCCAGG - Intronic
961203383 3:125061877-125061899 TGTAACAAAGTCCCACAAACTGG + Intergenic
961601076 3:128062493-128062515 TGTCACACAGGACCAAAAGGTGG + Intronic
961892290 3:130140371-130140393 TGTCACACACCAGCAAAAGCAGG - Intergenic
961927279 3:130494502-130494524 TACAACAAAGCACCACAAACTGG - Intergenic
962372198 3:134830044-134830066 TGTAACAAAGTACCACCAACTGG - Intronic
962946107 3:140172564-140172586 TGTAACAGAGTACCACAAACTGG + Intronic
963182642 3:142375171-142375193 TGTAACAAAGTACCACGAACTGG - Intronic
963275014 3:143321147-143321169 TATAACAAAGTACCACAAACTGG - Intronic
963669052 3:148229418-148229440 TGTAACAAAGTACCACAAACTGG + Intergenic
964305775 3:155338120-155338142 TGTAACAAAGTACCACAAAATGG - Intergenic
964431282 3:156608868-156608890 TTTTACAAAGCACCACAAACTGG - Intergenic
964485477 3:157181292-157181314 TGTAACAAAGTACCAAAAACTGG + Intergenic
964646673 3:158965839-158965861 TTTTACAAAGTACCACAAACTGG + Intronic
965290947 3:166879583-166879605 GGTAACAAAGTACCACAATCTGG + Intergenic
965702534 3:171472741-171472763 TATAACAAAACACCATAAGCTGG - Intergenic
965898731 3:173612726-173612748 TGTAACAAAGTACCACAAACTGG + Intronic
965903184 3:173669288-173669310 TGTAACAAAGTACCACAAACTGG + Intronic
965926502 3:173986669-173986691 TGAAACAAAGCACCTGAAGCGGG - Intronic
966387091 3:179410394-179410416 CATAACAAAGCACCACAAGCTGG + Intronic
966587054 3:181638096-181638118 TGTAATAAAGTACCACAAACTGG + Intergenic
967705772 3:192649041-192649063 TGTTAAAAATCAGCACAAGCAGG + Intronic
967726049 3:192863316-192863338 TGTAACAAATCACCACAAATTGG - Intronic
968802079 4:2749725-2749747 TGTAACAAAGTAACACAAACTGG - Intronic
969056317 4:4405020-4405042 TATAACAAAGTACCACAAACTGG + Intronic
969364930 4:6688868-6688890 TGGAACAAATCACCACAAACTGG - Intergenic
969421291 4:7098004-7098026 TGTAACAAAGTACCACCAACTGG - Intergenic
969712623 4:8852666-8852688 GGCCACAAAGCACCAAAACCAGG - Intronic
969820650 4:9717646-9717668 TATAACAAGGTACCACAAGCTGG - Intergenic
969967332 4:11010827-11010849 TGTAACAAAGTATCACAAACTGG - Intergenic
969978771 4:11132678-11132700 TGTCATAAAGCCCCACAAACTGG + Intergenic
970145067 4:13027434-13027456 TGTAACGAAGTACCACAAACTGG + Intergenic
970210607 4:13706129-13706151 TGTAACAAAGTACCACAAAGGGG + Intergenic
970340813 4:15104797-15104819 TGTAACAAATCACCACAGACTGG + Intergenic
970867660 4:20777661-20777683 TGTCACAAATTACCATAAACTGG - Intronic
971267199 4:25106120-25106142 TGTAACTAAGTACCACAAACTGG - Intergenic
971366808 4:25984225-25984247 TATCACAAAGGACCACAGCCTGG + Intergenic
972292769 4:37705248-37705270 TGTAACAAAATACCACAAACTGG + Intergenic
972432282 4:38994621-38994643 TGTAACAAAGTACCATAAACTGG + Intronic
972942980 4:44219705-44219727 TGTAACAAATCACCACAATTGGG - Intronic
973173025 4:47168741-47168763 TGTAGCAAAGTACCACAAACTGG + Intronic
973207387 4:47575739-47575761 TGTAACAAAGTACCACAGACAGG + Intronic
973208613 4:47589138-47589160 TGTCAGAAGCCACCAGAAGCTGG + Intronic
974419811 4:61658886-61658908 TGTAACAAAGTACCACAAACAGG + Intronic
974546535 4:63315735-63315757 GGTAACAAAGCACCACAAACTGG + Intergenic
975318199 4:72979307-72979329 TATAACAAAGTACCACAAACTGG - Intergenic
976676160 4:87705725-87705747 TGTAACAAATTACCACAAACTGG + Intergenic
976956580 4:90908916-90908938 CGTAACAAAGTACCACAAACTGG + Intronic
977366654 4:96077777-96077799 CATAACAAAGTACCACAAGCTGG + Intergenic
977895379 4:102358628-102358650 TGTAACAAAGTGCCACAAACTGG - Intronic
978171427 4:105675657-105675679 TGTAACAAAACACCATAAACTGG + Intronic
978227918 4:106360916-106360938 TGTAACAAAGTACCACAACCTGG - Intergenic
978581552 4:110236588-110236610 TGTCAGCAACCACCAGAAGCTGG - Intergenic
979262284 4:118662078-118662100 TGTAATAAAGTACCACAAACTGG + Intergenic
979312404 4:119219179-119219201 TGTAACAAAGAACCACAAACTGG + Intronic
979350053 4:119632881-119632903 CGTAACAAAGTACCACACGCTGG - Intergenic
979597372 4:122549005-122549027 TGTAACAAAGCACTAAAAACTGG - Intergenic
980516890 4:133875658-133875680 AGTCAAAAAGCAACACATGCTGG - Intergenic
980593195 4:134918199-134918221 AGTAACAAAGTACCACAAACTGG - Intergenic
980845957 4:138325380-138325402 TGTAACAAAGTAGCACAAACTGG + Intergenic
981218681 4:142204908-142204930 TATAACAAAGCACCACAAACTGG - Intronic
981281836 4:142967311-142967333 TGAAACAAAGCACCACAAACTGG - Intergenic
981749018 4:148075687-148075709 TGTAACAAAGGACCACAAATTGG - Intergenic
981819422 4:148868636-148868658 CATAACAAAGCACCACAAACTGG + Intergenic
981906472 4:149926741-149926763 TGTAACAAAGTACCATAAACTGG - Intergenic
982107707 4:152025064-152025086 TGTCACAGAGTACCACATGCTGG - Intergenic
982116732 4:152104430-152104452 CGTGACAAAGGACCACAGGCTGG - Intergenic
982363831 4:154553165-154553187 TGTAACAAAGTACCACAAACTGG + Intergenic
982727826 4:158924211-158924233 TGTAACAAAGTACCACAGACTGG - Intronic
983078456 4:163355040-163355062 CAAAACAAAGCACCACAAGCTGG + Intergenic
983149549 4:164261249-164261271 TGTAATAAAGTACCACAAACTGG - Intronic
983495558 4:168438662-168438684 TGTCACAAAGCACCACAAGCTGG - Intronic
984196079 4:176659800-176659822 TACAACAAAGTACCACAAGCTGG + Intergenic
984600347 4:181719375-181719397 TATAACAAAGTACCACAAACTGG + Intergenic
985256298 4:188073294-188073316 TCTCACTATGCACCCCAAGCTGG - Intergenic
985590196 5:760544-760566 CATCACAAAGCACCAAAAACCGG - Intronic
985609307 5:878026-878048 AGTGACAAAGCACCACAGACTGG - Intronic
985765600 5:1777824-1777846 TGTAACAAAGTACCACGGGCCGG - Intergenic
986100167 5:4600830-4600852 TGTCACAGAGTACCACAAATTGG - Intergenic
986200541 5:5574481-5574503 TGTCACAGAGTACCACAGCCTGG + Intergenic
986221710 5:5774578-5774600 CATCACAAAGCACCACAGACTGG + Intergenic
986529570 5:8722008-8722030 TGTTACAAAGCACAAAAATCGGG + Intergenic
986676935 5:10193990-10194012 TGTCACAAAGTACTACAAACTGG - Intergenic
986718982 5:10546330-10546352 TGTAACACAGCACCACAAATTGG + Intergenic
986990693 5:13549531-13549553 TGTAACAAAGTACCACAAACTGG + Intergenic
987263797 5:16230045-16230067 CGTAACAAAGCACCACAAACTGG - Intergenic
987268584 5:16281165-16281187 AGTAACAAAGAACCACAAACTGG + Intergenic
987299741 5:16586772-16586794 TGTAACAAAATACCACAGGCAGG + Intronic
987393419 5:17398173-17398195 TGTAACAATGTACCACAAACTGG - Intergenic
987641156 5:20614175-20614197 TGTAAAAAAGCAGCACAGGCTGG - Intergenic
987648177 5:20703793-20703815 TGTCCAAAAGCACCAGAAGGAGG + Intergenic
988355813 5:30172763-30172785 TATAACAAAGTACCACAAACTGG + Intergenic
988748152 5:34165093-34165115 TGTCCAAAAGCACCAGAAGGAGG - Intergenic
988806388 5:34744756-34744778 TGTAACAAATGACCACAAACTGG + Intronic
989255534 5:39362556-39362578 CATAACAAAGCACCACAAGCTGG - Intronic
989279929 5:39629071-39629093 TGTAACAAAGTATCACAAACAGG + Intergenic
989297027 5:39840831-39840853 TGACACAAAGTACCACAAACTGG - Intergenic
989596110 5:43157651-43157673 TGTAACAAAGTACCATAAACTGG + Intronic
990002329 5:50908718-50908740 TATAACAAAGTACCACAAGCTGG - Intergenic
990079529 5:51896567-51896589 TGTAACAAAGCACTACAAACTGG + Intergenic
990158002 5:52901401-52901423 TGTAACAAATTACCACAAGTTGG - Intronic
990324329 5:54660128-54660150 TGTAACAAACTACCACAAACTGG + Intergenic
990352883 5:54936607-54936629 CGTAACAAAGCACCACAGACTGG + Intergenic
990597243 5:57323983-57324005 TGTAACAAAGTACCACAAAGTGG - Intergenic
990671710 5:58137898-58137920 TGTAACAAAGTATCACAAACTGG - Intergenic
990980366 5:61597580-61597602 TGTAACAAAGCACCACAGACTGG + Intergenic
991032362 5:62095971-62095993 TGTGACAAAGTACCACAAACAGG + Intergenic
991084980 5:62640480-62640502 CATAACAAAGCACCACAAACTGG + Intergenic
991152169 5:63383142-63383164 CATAACAAAGCACCACAAACTGG - Intergenic
991532096 5:67626881-67626903 TGTCACAAGACACCAAATGCTGG + Intergenic
991643300 5:68775654-68775676 TGTAACTAAACACCACAAGGAGG + Intergenic
991984058 5:72264854-72264876 TGTAACAAAGTACCATAAACTGG - Intronic
992083894 5:73260701-73260723 TGTAACAAAGCACCACAACCTGG - Intergenic
992278158 5:75142937-75142959 TGTAACAAATTACCACAAACTGG + Intronic
992464236 5:76987990-76988012 CGCAACAAAGCACCACAAACTGG - Intergenic
992908386 5:81370762-81370784 CGTAACAAAGCACCACAGACTGG - Intronic
993484642 5:88467960-88467982 TGTAACAAAGTGCCACAAACTGG + Intergenic
993850688 5:93004465-93004487 TGTAACAAAGTACTACAAACTGG - Intergenic
994184474 5:96803067-96803089 TGTAACAAAGTACCACAGACTGG - Intronic
994671376 5:102765598-102765620 TGTAACAAAGTACCACAAACCGG + Intronic
994697087 5:103085976-103085998 TGTAACAAAGTCCCACAAACTGG + Intergenic
995058296 5:107786759-107786781 TGTTACAAAGCACCATAGACTGG - Intergenic
995240242 5:109877253-109877275 TGTAACAAATTACCACAAACTGG - Intergenic
995919220 5:117290750-117290772 TGTCACAAAGCCCCACAGGGTGG - Intergenic
996032665 5:118723198-118723220 TGTCATAAATGACCACAAGCTGG + Intergenic
996399030 5:123039843-123039865 TGTAACAAAGTGCCACAAACTGG - Intergenic
997389473 5:133502159-133502181 TGTAACAAAGTACCACAAAATGG - Intronic
997518782 5:134508895-134508917 TGTAACAAAGTGCCACAGGCAGG - Intergenic
997693688 5:135845030-135845052 TGTAACAAATAACCACAAACTGG + Intronic
997821731 5:137071941-137071963 TGTAACAAAGCGCCACTAACTGG - Intronic
997903433 5:137790211-137790233 TGTAACAAAGTACCACAGGCTGG + Intergenic
998044831 5:138978292-138978314 AGTCACAAAGCACCACATACTGG - Intronic
998532490 5:142898871-142898893 TGTAACAAAGTACCACAAATTGG + Intronic
998655747 5:144177382-144177404 TGTAACAAAGTACCACAAACTGG + Intronic
998723694 5:144984721-144984743 TATAACAAAGAACCACAAACTGG + Intergenic
998949254 5:147375311-147375333 TTTCACTAAGCAGCAAAAGCAGG - Intronic
998980105 5:147692400-147692422 TGTAACAAATTACCACAAACTGG - Intronic
999105719 5:149069200-149069222 TCTAACAAAGTACCACAAACTGG - Intergenic
999353353 5:150899221-150899243 TGTGACAAAGTACCACAAACTGG - Intronic
999632268 5:153583277-153583299 TGTAACAAAATTCCACAAGCAGG + Intronic
999698122 5:154204119-154204141 GGTCACAAAGCAACTCAAGGTGG - Intronic
1000865131 5:166504350-166504372 CGTAACAAAGTACCACAAACTGG + Intergenic
1001154795 5:169263586-169263608 TGTAACAATGTACCACAAACTGG - Intronic
1001275249 5:170345993-170346015 TGTCACAAATTACCCCAAACTGG + Intergenic
1001283058 5:170401864-170401886 TGACACAAATCACTACAAACTGG + Intronic
1001699098 5:173693944-173693966 TGTGACAAACTACCACAAACTGG - Intergenic
1002906398 6:1452689-1452711 TGTCACAAAGTACCACAGACTGG + Intergenic
1003030285 6:2595502-2595524 TGTAACCAATCACCACAAACGGG + Intergenic
1003644334 6:7902254-7902276 TGTAACAAAGTTCCACAAACCGG - Intronic
1003976963 6:11353602-11353624 TGTTACAAAGTACCATAAACTGG - Intronic
1004020410 6:11771316-11771338 TGTCCGAATTCACCACAAGCAGG + Intronic
1004083288 6:12417472-12417494 TGTAACAAAGTGCCACAAACTGG - Intergenic
1004089014 6:12480323-12480345 TGTAACAAAGCACCTCAGACTGG - Intergenic
1004233789 6:13855341-13855363 TGTAACAAAGTACCACAAACTGG + Intergenic
1004563176 6:16770777-16770799 TATAACAAAGTACCACAAACTGG - Intergenic
1004628773 6:17401386-17401408 TGTAACAAAACACCACAGACTGG - Intronic
1004975982 6:20966955-20966977 TGTAACAAAGTACCACAAACTGG + Intronic
1005103993 6:22203479-22203501 CGTAACAAAGTACCACAGGCTGG - Intergenic
1005169682 6:22968692-22968714 TGTTACAAAATACCACAGGCTGG + Intergenic
1005353317 6:24958734-24958756 TGTAACAAAGTACCACAAACTGG + Intronic
1005545729 6:26868195-26868217 TGTCCAAAAGCACCAGAAGGAGG - Intergenic
1005810763 6:29514079-29514101 TGTAACAATGTACCACAAACTGG - Intergenic
1005889090 6:30121699-30121721 CGTAACAAAGTACCACAGGCTGG - Intergenic
1006692524 6:35901531-35901553 TGTAACAAAGTACCAAAAACTGG - Intronic
1007270513 6:40632677-40632699 TGTACCAAAGCATCACAAACTGG - Intergenic
1007526774 6:42502887-42502909 CATCACAAAGTACCACAAACTGG - Intergenic
1007958618 6:45939007-45939029 TACAACAAAGTACCACAAGCTGG + Intronic
1008415298 6:51232981-51233003 TATGAAAAAGCACCACAAACTGG + Intergenic
1008526581 6:52413307-52413329 CGTAACAAAGTACCACAAGCTGG - Intergenic
1008810131 6:55486762-55486784 TATAACAAAGTACCATAAGCAGG + Intronic
1009016441 6:57908971-57908993 TGTCCAAAAGCACCAGAAGGAGG - Intergenic
1010002556 6:70962357-70962379 TGTAACAAAGTTCCACAAACTGG - Intergenic
1010447695 6:75966605-75966627 TGTCACAAAATACCACAGACTGG - Intronic
1010579433 6:77575691-77575713 TCTACCAAAGTACCACAAGCTGG - Intergenic
1010738887 6:79475718-79475740 TGTAACAAATTACCACAAACTGG + Intergenic
1010794254 6:80101060-80101082 TGTCACAAAGCAGCACAAACTGG - Intergenic
1010954000 6:82069742-82069764 TGTAACAAAGTATCACAAACTGG - Intergenic
1011219921 6:85043594-85043616 TGTAACAAAGTACCATAAACTGG - Intergenic
1011529015 6:88299617-88299639 CATCACAAAGTACCACAAACTGG + Intergenic
1011591629 6:88975602-88975624 TGTAACAAAAGGCCACAAGCTGG + Intergenic
1011788024 6:90868041-90868063 TGTAACAAAGTACCACAAACTGG - Intergenic
1011799120 6:90991126-90991148 TGTAACAAAGTACCATAAACTGG + Intergenic
1012149233 6:95725318-95725340 TGTAACAAAGTATCACAAACTGG + Intergenic
1012244447 6:96911088-96911110 CGTAACAAAGTACCACAAACTGG + Intergenic
1012638435 6:101578429-101578451 TATAAAAGAGCACCACAAGCCGG + Intronic
1012767051 6:103381027-103381049 TGTAACAAAGTACCGCAAACTGG + Intergenic
1012837945 6:104294092-104294114 TGTAACAAAGCTCCACGAGCTGG - Intergenic
1012842429 6:104345783-104345805 TGTCAAAAAGCAACAGATGCTGG - Intergenic
1013468157 6:110435486-110435508 TGTAACAAAATACCACAGGCTGG - Intronic
1013580252 6:111527007-111527029 CGTAACAAAGTACCACAAACTGG + Intergenic
1013971735 6:116028423-116028445 TGTAACAAAGCACTACAAATGGG + Intronic
1014477540 6:121891986-121892008 AGTCACAAAGCAAGAGAAGCAGG + Intergenic
1014609696 6:123526024-123526046 TGTAACAAATTACCACAAACTGG - Intronic
1014720694 6:124914080-124914102 TGTAACCAAATACCACAAGCCGG - Intergenic
1015212175 6:130710835-130710857 TGTAACAAAATACCACAAACTGG + Intergenic
1015442636 6:133266480-133266502 TATAACAAAGTACCACAAACTGG - Intronic
1015589671 6:134810899-134810921 TGTAACAAAGTACCATGAGCTGG - Intergenic
1015804263 6:137092508-137092530 TGTAACAAAGCACCACAAGTTGG + Intergenic
1016006265 6:139092094-139092116 TGTAACAAAGTACCACAAAGAGG - Intergenic
1016397676 6:143642906-143642928 TGTAACAAAGTACCATAAACTGG - Intronic
1016529901 6:145046167-145046189 TTTCACAAAACCCTACAAGCTGG - Intergenic
1017448070 6:154527229-154527251 CATGACAAAGTACCACAAGCTGG - Intergenic
1017594944 6:156018286-156018308 TATAACAAAGGACCACAAACCGG + Intergenic
1017989884 6:159477040-159477062 TGTAACGAAGCACCATAAACTGG - Intergenic
1020477020 7:8608144-8608166 TATAACAAAGTACCACAAACTGG - Intronic
1020827260 7:13044747-13044769 TGTAACAAAGTAACACAAACCGG - Intergenic
1020896368 7:13945090-13945112 TGTAACAAAGTATCACAAACTGG - Intronic
1021576717 7:22111951-22111973 TGTAACAAAATACCACAGGCTGG + Intergenic
1021915371 7:25426223-25426245 TGTAACAAAATACCATAAGCTGG + Intergenic
1021979648 7:26041633-26041655 TGTAACCAAGTACCACAAACTGG - Intergenic
1022156877 7:27669632-27669654 TGTAACAGAACACCACAAACTGG + Intergenic
1022248582 7:28584684-28584706 AGTCACAAATTACCACAAACTGG - Intronic
1022304105 7:29130093-29130115 TGTAACAAAACACCACCATCTGG - Intronic
1022357518 7:29629928-29629950 TGTAAGAAAGTACCACAAACTGG + Intergenic
1022367830 7:29742892-29742914 TGTAAGAAAGTACCACAAACTGG + Intergenic
1022387927 7:29918764-29918786 CGTCACAAAGTACCACAAACTGG - Intergenic
1022472083 7:30688328-30688350 TGGAACAAAGCACCACAGACTGG - Intronic
1022588662 7:31640314-31640336 TGTGAGAAACCACCAAAAGCTGG - Intronic
1022791766 7:33696211-33696233 TGTAACAAAGTACCACAAATTGG - Intergenic
1023092516 7:36630237-36630259 GGTTACAAAACACCACAAACTGG - Intronic
1023415488 7:39928231-39928253 TATAACAAAGTACCACAAGCTGG + Intergenic
1023845680 7:44118840-44118862 TGTAACAAAGCACCACAAACTGG - Intronic
1023902526 7:44493846-44493868 TGTCACAAAGTACCATAGACTGG - Intergenic
1023997400 7:45169527-45169549 TGTAACAAAGTACCATAATCTGG + Intronic
1024047065 7:45592174-45592196 TATAACAAAGCACCACAGACTGG + Intronic
1024192997 7:47031469-47031491 TGTGACAAGGAACCACAAACTGG - Intergenic
1024458808 7:49638622-49638644 CATCACAAACAACCACAAGCTGG + Intergenic
1024700714 7:51901460-51901482 TACCACAAAGCAACACAAACTGG + Intergenic
1026308272 7:69161319-69161341 TGTCACAAAGTACCATAGACTGG - Intergenic
1026990515 7:74582553-74582575 TATCAAAAAGCACTACAGGCTGG - Intronic
1027388618 7:77682914-77682936 TGTAACAAAGTATCACAAACTGG + Intergenic
1027706679 7:81542972-81542994 TGTAACAAAGTAACACAAACTGG - Intergenic
1027930945 7:84534259-84534281 TGTAACAAATTACCACAAACTGG + Intergenic
1028124738 7:87099794-87099816 TGTAACAAAGTAACACAAACTGG + Intergenic
1028671146 7:93401468-93401490 TGTAACAAATTACCACAAACTGG + Intergenic
1028848855 7:95513761-95513783 TGTCACAAGTTACCACAAACTGG - Intronic
1028940215 7:96513349-96513371 TGTAAGAAAGTACCACAAACTGG - Intronic
1029159712 7:98542995-98543017 TGTAACAAAGTACCACAAACTGG + Intergenic
1029295548 7:99537490-99537512 TGTAACAAAGTACCACAAACTGG - Intergenic
1029297816 7:99555436-99555458 TATAACAAAGTACCACAAACTGG - Intronic
1029796150 7:102896512-102896534 TGTAATAAAGTACCACAAACTGG + Intronic
1029801756 7:102955353-102955375 AGACACAACGCACCACAATCTGG + Intronic
1029892687 7:103947646-103947668 TGTAACAAAGTACTACAAACTGG - Intronic
1029969372 7:104773936-104773958 TGTAACAAAGTACCACAACCCGG - Intronic
1030074407 7:105724070-105724092 TGTAACAAAGTACCACAATTTGG + Intronic
1030173345 7:106626890-106626912 TGTGACAAATTACCACAAACTGG - Intergenic
1030247943 7:107406013-107406035 TGTAACAAAACACCATAAACTGG - Intronic
1030249435 7:107426167-107426189 TATAACAAAGTACCACAAACTGG - Intronic
1030346914 7:108444446-108444468 TGTAACAAAGTACCACAAAATGG + Intronic
1030419369 7:109288210-109288232 TGTAACAAATTACCACAACCAGG - Intergenic
1030688724 7:112511454-112511476 TGTAACAAAGTACCACAAACTGG + Intergenic
1030697970 7:112606987-112607009 TGTAAGAAAGTACCACAAACTGG - Intergenic
1030755877 7:113287271-113287293 AGTAACAAAGTACCACAAACTGG + Intergenic
1030778062 7:113561465-113561487 TGTAACAAAGTACCACAAACAGG + Intergenic
1030991830 7:116310292-116310314 TGTAACAAATGACCACAAACTGG + Intronic
1031258328 7:119484568-119484590 TGTAAAAAAGTACCACAAACTGG - Intergenic
1031281339 7:119804692-119804714 TGTAACAAAGTACCACCAACTGG + Intergenic
1031630977 7:124042494-124042516 TGTAACAAAGTACCATAAACTGG + Intergenic
1032181324 7:129681335-129681357 TCCCACAAATCACCACAAACTGG - Intronic
1032672800 7:134100404-134100426 TGTAACCAAGTACCACATGCTGG - Intergenic
1033018648 7:137698994-137699016 TCTAACAAAGCACCATAAACTGG + Intronic
1033249745 7:139748361-139748383 TATAACACAGCACCACAAGCTGG + Intronic
1033592058 7:142817403-142817425 TGTAATAAAGTACCACAAACTGG + Intergenic
1034032477 7:147783499-147783521 TGCCACAAAGTGCCACAAACTGG + Intronic
1034217698 7:149421020-149421042 TGTAACAAAGTGCCACAAACTGG - Intergenic
1034362344 7:150511296-150511318 TGTAACAAATTACCACAAACTGG - Intergenic
1034398978 7:150848881-150848903 TGTCACAGAGGACCACACACAGG - Intronic
1034476505 7:151287363-151287385 TGTAACAAATCACCACAAACTGG - Intergenic
1034842431 7:154411929-154411951 TATCACAAAATACCCCAAGCAGG + Intronic
1034954490 7:155326214-155326236 TGTAACAAAACACCACCACCTGG + Intergenic
1035071141 7:156145964-156145986 TGTAACAAAGTACCCCAAACTGG - Intergenic
1035582066 8:746765-746787 TACCACAAAGCACCACAGCCGGG + Intergenic
1035746844 8:1967248-1967270 TGTGACACAGTACCACACGCGGG + Intergenic
1035821679 8:2599393-2599415 TGTAACAAATTACCACAAACTGG - Intergenic
1035835945 8:2751874-2751896 TGTAACAGTGCACCACAGGCCGG - Intergenic
1036204240 8:6793753-6793775 TGTCACAAAGTGCCACAGACTGG + Intergenic
1036559822 8:9891854-9891876 TGTAACAAAAGACCACAAACTGG - Intergenic
1037131719 8:15414508-15414530 TATAACAAAGTACCACAAACTGG + Intergenic
1037161196 8:15774617-15774639 TGTAACAAAGTACCACAAAATGG - Intergenic
1037727853 8:21498019-21498041 TGTAACCAAGTACCACAAACTGG - Intergenic
1037755701 8:21708898-21708920 TGTAGCAAAGTACCACAAGCTGG - Intronic
1038004681 8:23419531-23419553 CATGACAAAGCACCACAAACTGG + Intronic
1038030640 8:23635660-23635682 TGCAACAAAGCATCACAAACTGG - Intergenic
1038665685 8:29535449-29535471 TATAACAAAGTACCACAAACTGG + Intergenic
1038704111 8:29878219-29878241 TGTAACAAATTACCACAAACCGG + Intergenic
1039833441 8:41236289-41236311 TGTAACAAAGTACCATGAGCCGG + Intergenic
1039834246 8:41243840-41243862 TGTAACAAAGTATCACAAACAGG - Intergenic
1040541560 8:48361779-48361801 TGTAACAAAATACCACAGGCTGG + Intergenic
1040690340 8:49929593-49929615 TGTCACCCAGCAGCACAGGCTGG - Intronic
1041348729 8:56928243-56928265 TGTTACAAAGGACCACAAACTGG - Intergenic
1041439981 8:57884136-57884158 TCTCAGAAAGCAGCAAAAGCAGG + Intergenic
1041597100 8:59667659-59667681 TATAACAAAGTACCACAAACTGG + Intergenic
1041812429 8:61926538-61926560 TGTTACAAATCACCACAAACTGG - Intergenic
1042356553 8:67834846-67834868 TGTAACAAAGTACCACAAACTGG + Intergenic
1042458186 8:69029715-69029737 TGTAACAAAGAACCACAAACTGG - Intergenic
1042478107 8:69272614-69272636 TGTAACAAACTACCACAAACTGG - Intergenic
1042693567 8:71530405-71530427 TGTAACAAAGTACCACAAAGTGG - Intronic
1042906362 8:73776298-73776320 TGTAATAAAGTACCACAAACTGG + Intronic
1043392786 8:79807755-79807777 CATCACAAAGGACCACAGGCTGG - Intergenic
1043735641 8:83739715-83739737 TGTAACAAAGTACCACAAACTGG + Intergenic
1043996895 8:86829026-86829048 TGTGACAAAACACCACAGACTGG + Intergenic
1044208327 8:89518958-89518980 TATAACAAAGTACCACAAACTGG + Intergenic
1044688939 8:94857485-94857507 TGTAACAAGGTACCACAAACTGG + Intronic
1044953706 8:97458137-97458159 TTTAACAAAGCACTACAAACTGG - Intergenic
1045230612 8:100303107-100303129 TGTAACAAACTACCACAAACTGG + Intronic
1045468532 8:102490623-102490645 TGTAACAAACTACCACAAACTGG - Intergenic
1045469080 8:102495202-102495224 TGTCACAAAGTACAATAAACTGG - Intergenic
1045508151 8:102793270-102793292 TGTAACAAAATACCACAATCTGG - Intergenic
1045550825 8:103170724-103170746 TGTAACAAAGAACCAAAAACTGG - Intronic
1045969964 8:108068921-108068943 TGTGACAAAGTACTACAAACTGG - Intronic
1046303065 8:112323648-112323670 TGAAACAAAGTACCACAAACTGG - Intronic
1047047754 8:121073817-121073839 TGTAACAAAGCACCACAAACTGG - Intergenic
1047221727 8:122924107-122924129 TGTAACAAAGCACCACAAACTGG + Intronic
1047303919 8:123637979-123638001 TGTTACAAAGTACCACAAACTGG - Intergenic
1047361887 8:124176628-124176650 TGTAACAAAGTACCACCAACTGG - Intergenic
1047407345 8:124596623-124596645 TGTAACAAAGCAACCCAAACTGG + Intronic
1047438076 8:124851832-124851854 TGTAACAGAACACCACAGGCTGG + Intergenic
1047909786 8:129515578-129515600 TGTAACATAGTACCACAAACTGG + Intergenic
1048010173 8:130449043-130449065 TCTTACAAAGCGCCAGAAGCCGG - Intergenic
1048010176 8:130449070-130449092 TCTAACAAAGCGCCAGAAGCCGG - Intergenic
1048133663 8:131724804-131724826 TGTCATAAATGACCACAAACTGG - Intergenic
1048301158 8:133252417-133252439 TGTAACAAATTACCACAAACAGG - Intronic
1048314471 8:133351918-133351940 TGTAACAAAGTACCACAGACTGG + Intergenic
1048542826 8:135358280-135358302 TGTAACAAAGCACTACAAACTGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048599335 8:135902381-135902403 TGTAACAAAGTACCACAACCGGG + Intergenic
1049157885 8:141078055-141078077 CATGACCAAGCACCACAAGCTGG + Intergenic
1049241649 8:141540411-141540433 TGGTACAAAGCACCACAGGCTGG + Intergenic
1049487025 8:142871012-142871034 TATAACAAAGCACCACAGACTGG - Intronic
1049614585 8:143570549-143570571 GGTCACACAGCTGCACAAGCTGG - Exonic
1049738168 8:144221136-144221158 GGTCACAGAGCATCACAACCAGG + Intronic
1049907142 9:228670-228692 TGTAACAAACTACCACAAACTGG - Intronic
1050047020 9:1557599-1557621 TGTAACAAAACACCACATACTGG - Intergenic
1050164105 9:2746440-2746462 TGTAACAAAGTAGCACAAGCTGG - Intronic
1050683872 9:8145484-8145506 CATCACAAAGTACCACAAACTGG - Intergenic
1050836178 9:10081661-10081683 TATCACAAAGCACCATAGACTGG - Intronic
1051422190 9:16900323-16900345 TGTCATAAAGATCCACAAGCTGG - Intergenic
1051481708 9:17568954-17568976 TGTAACAGAGGACCACAAACTGG - Intergenic
1051745642 9:20292540-20292562 TGTAACAAAGTACCACAAACTGG + Intergenic
1052079430 9:24185981-24186003 TGTAAGAAAGTACCACAAACTGG + Intergenic
1052366463 9:27617418-27617440 TGTGACAAAATACCGCAAGCTGG + Intergenic
1052898213 9:33768010-33768032 TGTAACAAAGGCCCACAGGCTGG - Intronic
1053241590 9:36499989-36500011 TGTAACAAAGTACTACAAACTGG + Intergenic
1053735762 9:41101333-41101355 TGTCACAAAATACCAGAAACTGG - Intergenic
1054692614 9:68330065-68330087 TGTCACAAAATACCAGAAACTGG + Intronic
1054711185 9:68512392-68512414 TATAACAAAGTACCACAAACTGG + Intronic
1054727430 9:68666272-68666294 TGTCACAAAGTATCACAAACTGG + Intergenic
1054772284 9:69094070-69094092 TGTAACAAAGTTCCACAAACGGG + Intronic
1054780012 9:69157364-69157386 AGTAACAAAGCACCATAAACTGG + Intronic
1054906061 9:70414259-70414281 TGTCCCAAAGCTCCGCAAGCTGG - Exonic
1056485457 9:87052758-87052780 TGTAACAAATCACCACAAACTGG + Intergenic
1056760395 9:89410451-89410473 AGTCACAAAGAAACACAACCTGG + Intronic
1056839399 9:89986406-89986428 TGTGACAGAGCACCACAGCCTGG + Intergenic
1056891603 9:90499387-90499409 TGTAGCAAAGCACCACAAATTGG + Intergenic
1057052508 9:91936245-91936267 CGTAACTAAGCACCACAAACTGG + Intronic
1057276639 9:93679702-93679724 TCACACACAGCACCCCAAGCTGG + Intergenic
1057399326 9:94708961-94708983 TATCACATAGCCCCACAAGTAGG - Intergenic
1057559465 9:96115919-96115941 TGCCAGGAAGCACCACAAGTTGG - Intronic
1057855008 9:98595058-98595080 TATCACAAAATACCACAAACTGG + Intronic
1058214530 9:102217303-102217325 TGTAACAAAATACCACAAACTGG - Intergenic
1058369104 9:104244151-104244173 TATGACAAAGTACCACAAACTGG - Intergenic
1059092405 9:111373858-111373880 AGGCACACAGCATCACAAGCAGG + Intronic
1059400316 9:114065545-114065567 CGTAACAGAGAACCACAAGCTGG - Intronic
1059722097 9:116969870-116969892 TGCAACAAATCACCACAAACTGG + Intronic
1059811226 9:117857820-117857842 AGTTACAAAGAACCACAAACTGG + Intergenic
1059850842 9:118337369-118337391 TGCAACAAAGTACCACAACCTGG - Intergenic
1060171557 9:121465735-121465757 TATAACAAAGTACCACAAGGTGG - Intergenic
1060303242 9:122388579-122388601 TGCAACAAAGTACCACAAACTGG + Intronic
1060539259 9:124418824-124418846 TATAACAAAGTACCACAATCTGG - Intergenic
1062225779 9:135449328-135449350 TGTCACAAACAAAAACAAGCAGG - Intergenic
1062393765 9:136344333-136344355 CCTCACAAAGCACCGCAGGCCGG + Intronic
1185779984 X:2835776-2835798 TGTGAGAAAGTACCACACGCTGG - Intronic
1186113288 X:6278091-6278113 TGTAACAAAGTACCACAACCCGG + Intergenic
1186402978 X:9276810-9276832 TGTAACAAAGTATCACAAACTGG + Intergenic
1187299195 X:18031497-18031519 TGTAATAAAGCACCACAAACTGG - Intergenic
1187424947 X:19168895-19168917 TGTCACAAAACACCACAGGCTGG - Intergenic
1187448291 X:19376167-19376189 TGTAACAAAATACCACAAACTGG + Intronic
1187706313 X:22012972-22012994 TGTAACAAAGTACCATAAACTGG - Intergenic
1187811965 X:23189416-23189438 TGTAACAAAGCACGACAAATTGG + Intergenic
1188213260 X:27447969-27447991 TGTTACAAATCACCACAAACTGG + Intergenic
1188392100 X:29633565-29633587 TGTAACAAATTACCACAAGCTGG + Intronic
1188604157 X:32007473-32007495 TGTAACAAATTACCACAAGCTGG - Intronic
1188968138 X:36580108-36580130 TGTAACAAAGTATCACAAACTGG + Intergenic
1189136719 X:38558279-38558301 TGTAACAAAGTACCACAAGCTGG + Intronic
1189193259 X:39129854-39129876 TGCAACAAAGTACCACAAACTGG + Intergenic
1189213626 X:39304992-39305014 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1189343178 X:40220022-40220044 TGTAACAAAGTACCACAAACTGG + Intergenic
1189643146 X:43095767-43095789 TGTAACAAGGTACCACAAACTGG - Intergenic
1190492639 X:50998180-50998202 TGTAACAAAGCACTACACCCTGG - Intergenic
1190969412 X:55334288-55334310 TGGCACAAAGCAGCACTTGCAGG - Intergenic
1192543245 X:71992761-71992783 TGTCTTACAGCCCCACAAGCGGG - Intergenic
1193686482 X:84582603-84582625 TGTAACAAAATACCACAAACTGG + Intergenic
1193773042 X:85610234-85610256 TATAACAAAGTACCACAAACTGG - Intergenic
1194816758 X:98451089-98451111 TATAACACAGCACCACAAACTGG - Intergenic
1194831395 X:98626621-98626643 TGTGGCAAAGTACCACAAACTGG - Intergenic
1195284529 X:103371157-103371179 TGTAACAAAGTATCACAAACTGG + Intergenic
1195628914 X:107033452-107033474 TGTAACAAAGTACCACAGACTGG - Intergenic
1197863757 X:130996970-130996992 TGTAACAAAGTACCACAAACCGG - Intergenic
1198022009 X:132668312-132668334 TGTCACAATGCCCCACACCCTGG + Intronic
1198436792 X:136625084-136625106 TGTAACAAAGTACCATAAACTGG - Intergenic
1198573957 X:137989629-137989651 TGTAACAAAGTACCACAAACTGG + Intergenic
1198620264 X:138500090-138500112 TGAAACAAAGTACCACAAACTGG - Intergenic
1199755810 X:150864053-150864075 TGTAACAAAGTATCACAAACTGG - Intronic
1199935836 X:152572731-152572753 TGTAACAAAGTACCACAGCCGGG + Intergenic
1200275174 X:154725232-154725254 TGTAACAAAGTACCACAGACTGG - Intronic
1201232740 Y:11880297-11880319 TATAACAAAGAACCACAAACTGG - Intergenic
1201290065 Y:12414213-12414235 TGTGAGAAAGTACCACACGCTGG + Intergenic
1201304796 Y:12541411-12541433 TGTCACCAAGAACCACAGGCAGG - Intergenic
1202384358 Y:24310570-24310592 TGTAATAAAGTACCACAAACTGG + Intergenic
1202391065 Y:24371070-24371092 TATAACAAAGCACCACAGCCTGG - Intergenic
1202479719 Y:25299046-25299068 TATAACAAAGCACCACAGCCTGG + Intergenic
1202486425 Y:25359552-25359574 TGTAATAAAGTACCACAAACTGG - Intergenic