ID: 983502316

View in Genome Browser
Species Human (GRCh38)
Location 4:168513194-168513216
Sequence CCTTCTTTGCATCACATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983502316_983502321 30 Left 983502316 4:168513194-168513216 CCTTCAATGTGATGCAAAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 171
Right 983502321 4:168513247-168513269 AATCAAGTCAGGAGCTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
983502316_983502320 19 Left 983502316 4:168513194-168513216 CCTTCAATGTGATGCAAAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 171
Right 983502320 4:168513236-168513258 AAAGAAAGATAAATCAAGTCAGG 0: 1
1: 0
2: 3
3: 87
4: 1019

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983502316 Original CRISPR CCTTCTTTGCATCACATTGA AGG (reversed) Intronic
902891550 1:19447964-19447986 CCCTCTTTTCTTCACACTGACGG - Intronic
903233388 1:21935295-21935317 CCTTCTCAGCAACACATGGAGGG - Intronic
907300352 1:53482960-53482982 CCTGCTTGGCATGACATTCAAGG - Intergenic
907689968 1:56653840-56653862 TCTTCTGTGCATCACTTGGAAGG + Intronic
908254338 1:62290587-62290609 CTTTCCTTGCTTCACATTGTGGG - Intronic
909095704 1:71285444-71285466 GCTTCTTGGCTTCAAATTGATGG + Intergenic
909375669 1:74938973-74938995 ACTTCTTTGCATGATATTAAAGG - Intergenic
911035705 1:93544276-93544298 CCTTCTGTATATCACATTTAAGG - Intronic
911241733 1:95475310-95475332 GCTTCTTTGCATCAGATTCCTGG - Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
915545624 1:156595821-156595843 CCGTCTTGGGATCACAATGAAGG - Exonic
916888482 1:169093829-169093851 CCTTCTCTGCCTCATCTTGAGGG - Intergenic
919618411 1:199835958-199835980 CCTTCTTTGCCTCTCATTGTGGG - Intergenic
920023475 1:202974355-202974377 GCTTCTTTGCATGTCATTTAAGG - Intergenic
923737664 1:236626740-236626762 TGTTCTCTGCATCATATTGAAGG + Intergenic
923873144 1:238018315-238018337 ACTGCTTTCCATCACATTCATGG - Intergenic
1064416342 10:15153499-15153521 ACTTCGTTGCCTCCCATTGATGG + Intronic
1071397504 10:85238288-85238310 CCCTCTTTGCCTCACTTTTAAGG - Intergenic
1078188429 11:9072150-9072172 CCTTCTTTTAATCACTTTGAAGG + Intronic
1079356513 11:19734521-19734543 ACTGCTTTACATCAGATTGAGGG - Intronic
1079775832 11:24525556-24525578 ATTTCTCTGCATCACATTAAAGG - Intronic
1080854126 11:36096975-36096997 CCTTGTTTGAATCACACTGCAGG + Intronic
1081702493 11:45160922-45160944 CCTTCTTTCCTTCACATACAGGG + Intronic
1081707757 11:45195048-45195070 CCTTCCTGGCATCCCATTGCTGG + Intronic
1082218616 11:49604865-49604887 TCTTATTTGCATCATATCGAGGG - Intergenic
1082863164 11:57874275-57874297 CCTTCTTTGCTGAACATTGAGGG + Intergenic
1084900667 11:72307723-72307745 CCTTCTTTGTAACACAGAGAAGG + Intronic
1086630954 11:89019253-89019275 TCTTATTTACATCATATTGAGGG + Intronic
1087135116 11:94708608-94708630 CCTTCTTTCCTTCACTTTTAAGG + Intronic
1087620670 11:100538094-100538116 CCTCCTTTACTTCAGATTGAGGG + Intergenic
1087698616 11:101410819-101410841 CCTTCTTTTCATCACGTTGATGG - Intergenic
1087898057 11:103609708-103609730 ACTACTTTGCTTCACAATGAGGG - Intergenic
1088304029 11:108389274-108389296 CCTTCTTTCCAGCACATTTATGG - Intronic
1088947139 11:114525624-114525646 CCTTCTGTGCAGCACAGTGAAGG + Intronic
1091182753 11:133621624-133621646 CTTTCTTTACTTTACATTGAAGG - Intergenic
1093485883 12:19651945-19651967 CCCTATTTGCATCACCTTGCGGG + Intronic
1093889177 12:24498972-24498994 CCTTCTTTGCATTCAAGTGATGG + Intergenic
1094258386 12:28463456-28463478 GCTTCTGTGCATCACATTTAAGG - Intronic
1096031515 12:48420124-48420146 CTTTATTTGCATCACATTCTTGG - Intergenic
1099390408 12:82072063-82072085 CCTTCTTTTGATGGCATTGATGG + Intergenic
1099894745 12:88630887-88630909 CCTTATTTGCCTAACATTTATGG + Intergenic
1101058173 12:100941808-100941830 CCTTAGTTGCATCACATTCTTGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106976947 13:35229841-35229863 CCTTCTTTGGAATACATTGTGGG + Intronic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1109204289 13:59464811-59464833 GCTTCTTGGCTTCACATTCAAGG - Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1116557051 14:46324240-46324262 CTCTCATTGCATCACTTTGAAGG + Intergenic
1117620018 14:57576052-57576074 CCTTCTGTGCATCTCCATGAGGG + Intronic
1118430991 14:65718598-65718620 CCTTTTTTCCTTCAAATTGAAGG + Intronic
1118984889 14:70745436-70745458 CCTTCTTTCTATCACTTTTATGG - Intronic
1120407781 14:84110388-84110410 ACTTCTTTGCAAGATATTGATGG + Intergenic
1120584187 14:86290849-86290871 CCATCTATGCATCATACTGAGGG - Intergenic
1121217062 14:92256527-92256549 CTTGCTTTGCATGACTTTGACGG + Intergenic
1122894510 14:104749762-104749784 CCTGCCCTGCATCAGATTGATGG - Intergenic
1122966798 14:105134014-105134036 CCTTCTTTCAATTACATTTATGG + Intergenic
1124944878 15:34255513-34255535 ACATCTTTTTATCACATTGAGGG - Intronic
1126957748 15:53953234-53953256 CCTACTTTGCATCAGATTAATGG - Intergenic
1132916069 16:2345230-2345252 CCACCATTGTATCACATTGATGG - Intergenic
1133680800 16:8118080-8118102 GCTTCTCTGCATCACACTGGTGG + Intergenic
1137237564 16:46628030-46628052 CCGGCTTTGCAGCACAGTGAAGG - Intergenic
1138404712 16:56781153-56781175 ACTTCTTTGCACAACATTTAGGG - Intronic
1138748963 16:59395884-59395906 CAATCTTTGCATCACAATGCAGG + Intergenic
1139447358 16:67006071-67006093 CTTTCTTGGCCTCATATTGAAGG - Intronic
1141380766 16:83574607-83574629 CCTCATTTGCATCACAGGGATGG + Intronic
1142204426 16:88776120-88776142 CCTTCTGTGCACCACAGTGTGGG - Intronic
1146891185 17:36507433-36507455 CCCTGTTTGGATCTCATTGAGGG - Exonic
1149452446 17:56760419-56760441 CTTTCTTGGCATCACAGTGCAGG - Intergenic
1152978200 18:245208-245230 CCTTCTTAGCATTAGATTTATGG + Intronic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1156099709 18:33578613-33578635 TCATGTTTGCATCTCATTGATGG - Exonic
1156375978 18:36515660-36515682 CCTTCTTGGCATGTCATAGAAGG - Intronic
1157112877 18:44837555-44837577 CTGTCTTTGCATCACATGGATGG + Intronic
1158229297 18:55235389-55235411 CCTTCCTTGCATGGCAATGATGG - Intronic
1158486996 18:57876429-57876451 CCTACTTTTCACCCCATTGAAGG - Intergenic
1160458871 18:79022469-79022491 CCTTCTCTGAGTGACATTGATGG + Intergenic
1161800475 19:6414715-6414737 CCTTCTCTGCATCACTTTTTTGG - Intronic
1162926750 19:13934108-13934130 CCTTCTTTGAATCACTTTATTGG - Intronic
1163819790 19:19489712-19489734 CCTTCTTATCATCTTATTGAGGG - Intronic
1164490695 19:28711327-28711349 CCTTCTTTGAATCAGCTAGAGGG + Intergenic
925796130 2:7544763-7544785 CCTTCTTTGCATCTCTCTGTGGG + Intergenic
926487854 2:13485392-13485414 TATTTTTTGTATCACATTGATGG - Intergenic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931581379 2:63779039-63779061 CCTTCTTTGAATCCCAATGTTGG + Intronic
934012281 2:87835719-87835741 CCTTCTGTGCAGCACAACGAAGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
936656288 2:114491454-114491476 CTTTCTTTGCATCTCCATGAAGG + Intronic
938647190 2:133343979-133344001 GCTTCTTCACATCACATTCAAGG - Intronic
938802735 2:134777862-134777884 CCTTCTTTGCTTCAGAGAGAAGG + Intergenic
940877297 2:158910872-158910894 CCTGATTACCATCACATTGAGGG - Intergenic
942796490 2:179826486-179826508 CCCTCTTTGCTTCACAGAGATGG - Intronic
944071917 2:195680492-195680514 CTTTCTCTGGATCACATTTATGG - Exonic
944074471 2:195713017-195713039 TCTTCTTTACGTCACATTCAGGG + Intronic
945393116 2:209288493-209288515 CCTTCTTTCCTTCTAATTGATGG - Intergenic
1169393883 20:5212990-5213012 CTTTCATTTCAGCACATTGATGG - Intergenic
1169793179 20:9433232-9433254 CTTTATATGCATCACATTGAGGG - Intronic
1169870027 20:10240139-10240161 ACTTCCTTGCATCACCCTGAGGG + Intronic
1170414489 20:16125486-16125508 CCTCTGGTGCATCACATTGAAGG + Intergenic
1170497874 20:16944365-16944387 CTTTCAGTGCATCACGTTGAGGG + Intergenic
1173890785 20:46508355-46508377 TCTTCTTTGCATTACATGTAGGG - Intronic
1175624575 20:60479759-60479781 CCATCTATGCATAACATTGTGGG + Intergenic
1179326972 21:40356594-40356616 GCTTCTTTACATCACCTGGAAGG + Intronic
1179462431 21:41546538-41546560 CCTTTTTTGGATTACATTGTGGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181789625 22:25254568-25254590 TCTTCTTTGTATCACAGAGAGGG + Intergenic
1182839394 22:33374728-33374750 TCTTCTTTGCATTACATTTATGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949317659 3:2774465-2774487 CCTTGTGTGCATCAAAATGAAGG + Intronic
950516015 3:13465890-13465912 CCCTCTTTGCATTCCACTGAAGG + Intergenic
951598968 3:24351414-24351436 ACTTCGTTGCAACACATTAATGG - Intronic
952684414 3:36132194-36132216 CTTTCTTTGCATGACCATGAGGG + Intergenic
952692315 3:36224354-36224376 TCTTATTTGCAGCACATAGAAGG + Intergenic
953544550 3:43854777-43854799 ACTTCTTTGCATAACCATGAAGG - Intergenic
958513475 3:95080484-95080506 CCTTCTTAGCCTCCCATTGAAGG - Intergenic
962024468 3:131532660-131532682 TCTTCATACCATCACATTGAGGG - Intergenic
963362011 3:144286433-144286455 CCTTCTTGGTTTCACATTGATGG - Intergenic
963853817 3:150233854-150233876 CCTACTTTGCATTAGATTCATGG - Intergenic
965980499 3:174683985-174684007 TTTTCTATGCATCACATTTAGGG + Intronic
966020122 3:175199183-175199205 CCTCTTTTGAATGACATTGAAGG + Intronic
966572307 3:181458887-181458909 CTTTCTTTTCAGCTCATTGATGG + Intergenic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
968173729 3:196530411-196530433 CTTTCTTTTCATCATCTTGATGG + Intergenic
968472477 4:788357-788379 CCTCCTTTCCATCTCACTGAAGG - Intronic
976274097 4:83258471-83258493 CCTTCTTGCCATCTCATTAATGG - Intergenic
977844903 4:101757143-101757165 CCCTTTTTGCATGACAGTGATGG + Intronic
977970612 4:103209618-103209640 CCCTCTTTGCATCACCTTATGGG - Intergenic
983502316 4:168513194-168513216 CCTTCTTTGCATCACATTGAAGG - Intronic
987396306 5:17427722-17427744 CCCTCTTTACGTCACAGTGAGGG - Intergenic
987623837 5:20371583-20371605 CTTTCTTTGCTTCCCATTGCAGG - Intronic
988986946 5:36629716-36629738 CCTCCTTTCCATCATTTTGAAGG - Intronic
990946156 5:61252027-61252049 CCTCCCTTGCATTGCATTGAAGG + Intergenic
991127040 5:63081183-63081205 TTTTCTTTGCATGCCATTGATGG - Intergenic
991901671 5:71467167-71467189 CCCTCTTGGAATCACATTGTAGG + Intronic
993870923 5:93253069-93253091 CCTTCACTGCATCATAGTGATGG + Intergenic
995931234 5:117448007-117448029 TCTTCTGTGAATCACACTGAAGG - Intergenic
998921498 5:147073277-147073299 GGTTCTTTGCATAACATTGAAGG - Intronic
999887406 5:155938012-155938034 CTTTCTTTGAACCACAGTGATGG + Intronic
1000522421 5:162313027-162313049 ACTTCTATCAATCACATTGAGGG - Intergenic
1000529897 5:162406591-162406613 CCTCCCTTGCATCACACTCATGG + Intergenic
1002870216 6:1160331-1160353 CCTTTTTGCCATCACACTGATGG - Intergenic
1003212676 6:4081038-4081060 CTTTCTTTTCAACACCTTGAAGG + Intronic
1005275601 6:24213840-24213862 CCCTCTTTGCATCACCTTTCTGG + Intronic
1005679519 6:28192260-28192282 CCTTTTTTGGATCATGTTGATGG + Intergenic
1008342381 6:50383165-50383187 CCCTCTTTGCATCACCTTGTGGG + Intergenic
1011929757 6:92696649-92696671 GCTTCTTTGCTTCAATTTGAAGG - Intergenic
1012089833 6:94877087-94877109 CTTTTTATGCATCACATTGTGGG + Intergenic
1012901433 6:105011544-105011566 CCTTCTTTACATCACCCTGTGGG + Intronic
1015589241 6:134806468-134806490 CTTTCTTCAAATCACATTGATGG + Intergenic
1016842665 6:148540071-148540093 CTTTCTTTGCTTCTCCTTGATGG + Intronic
1017417150 6:154233312-154233334 TTTTCTTTGCATCAGATTAATGG + Intronic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1020603946 7:10311267-10311289 CCTTCTTTGGAGCACAATCATGG + Intergenic
1022581568 7:31560363-31560385 ACTTCTTTGTAACACTTTGAAGG - Intronic
1023816266 7:43952576-43952598 TGTTCTCTGCAGCACATTGAAGG + Intronic
1025762987 7:64412230-64412252 CCTTCTTTGGAGCACAGTGGGGG - Intergenic
1026087373 7:67273545-67273567 TTTTCTTTGCATCTCATTAATGG - Intergenic
1026500640 7:70940551-70940573 ACTTCTTAGCATGACATTCAGGG + Intergenic
1026555008 7:71400394-71400416 CCTTTTTTACATCACTTTGCAGG + Intronic
1030782781 7:113622832-113622854 CCTTCTTTCCAGCACTTTGTAGG - Intergenic
1032277122 7:130467731-130467753 CAGTCTTTGCATGACCTTGACGG + Intergenic
1033410781 7:141115523-141115545 CCTACTTTTCATCAAATTAAGGG - Intronic
1038934614 8:32235044-32235066 CCTTCTTTGTCTGACTTTGAGGG - Intronic
1040871631 8:52105626-52105648 CCTTCTCCCCATCACATGGAGGG - Intergenic
1043430704 8:80191630-80191652 CCCTCTTTGCATCACCTGGTAGG + Intronic
1043581889 8:81724069-81724091 CTCTCTTTCCATCCCATTGAGGG + Intronic
1045321203 8:101082752-101082774 CCTTCTTTGCTTTACTTTCAGGG - Intergenic
1046845951 8:118916245-118916267 GCTTCTTAGCTTCACAGTGAAGG - Intergenic
1047541674 8:125773258-125773280 CCATCTTTGCATCACTAGGATGG + Intergenic
1048507123 8:135031676-135031698 CCTTCTCTGCCACTCATTGATGG + Intergenic
1054828773 9:69600178-69600200 CCTTCTTTGCATTTCCTTGAAGG - Intronic
1055130384 9:72767987-72768009 CCATCTTTGTAGCATATTGAGGG - Intronic
1055811743 9:80156861-80156883 CCTCCTTTGCATCCCTTTGCTGG + Intergenic
1056195240 9:84222366-84222388 CCTTCTTTGCATCACTCTGTGGG - Intergenic
1061996716 9:134189898-134189920 CCTGCTTTGCACCAGATGGAAGG - Intergenic
1062092847 9:134687594-134687616 CCTTCTGTGCATCAGATGGTCGG + Intronic
1186228563 X:7428142-7428164 ACTTCTTTGCAACACCCTGAAGG + Intergenic
1187115765 X:16348856-16348878 GCTTCTTTGCATCAGAAGGAAGG - Intergenic
1188666616 X:32830120-32830142 TCTTCAATGCCTCACATTGACGG + Intronic
1190473846 X:50809000-50809022 CCTTCTTTGTATCTCTCTGATGG + Intronic
1194665169 X:96669942-96669964 CCTTCTTTGCGTCACACTATGGG - Intergenic
1194861297 X:99001734-99001756 CCTTCTTAGCCTCACAGTGGAGG - Intergenic
1195009349 X:100720049-100720071 ACTTCTATGTATCACATTTATGG - Intronic
1197504523 X:127285206-127285228 CCTTTTTTGTTTCAAATTGAAGG + Intergenic
1199099193 X:143779161-143779183 CCTTCTGTGCAGCACAGTGAAGG + Intergenic
1199132202 X:144202822-144202844 CCTTCTGTGCAGCACAACGAAGG + Intergenic
1201667811 Y:16478692-16478714 CCTTCTGGGCAGCACAGTGAAGG + Intergenic