ID: 983508178

View in Genome Browser
Species Human (GRCh38)
Location 4:168578000-168578022
Sequence AAGAACATTGAAAAGTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 440}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983508178_983508180 9 Left 983508178 4:168578000-168578022 CCATACTACTTTTCAATGTTCTT 0: 1
1: 0
2: 2
3: 28
4: 440
Right 983508180 4:168578032-168578054 TGTGTGCTTCCTTTGGATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 170
983508178_983508179 2 Left 983508178 4:168578000-168578022 CCATACTACTTTTCAATGTTCTT 0: 1
1: 0
2: 2
3: 28
4: 440
Right 983508179 4:168578025-168578047 AATTTAATGTGTGCTTCCTTTGG 0: 1
1: 1
2: 3
3: 22
4: 298
983508178_983508182 20 Left 983508178 4:168578000-168578022 CCATACTACTTTTCAATGTTCTT 0: 1
1: 0
2: 2
3: 28
4: 440
Right 983508182 4:168578043-168578065 TTTGGATGCAGGATATACTGAGG 0: 1
1: 1
2: 0
3: 7
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983508178 Original CRISPR AAGAACATTGAAAAGTAGTA TGG (reversed) Intronic
901252758 1:7793686-7793708 GGGAACTATGAAAAGTAGTAAGG + Intronic
902007415 1:13243342-13243364 AAGAACTTTGAAATGTGGCAGGG - Intergenic
902026386 1:13387175-13387197 AAGAACTTTGAAATGTGGCAGGG - Intergenic
902095505 1:13941214-13941236 AAAAACAATAAAAAGGAGTAGGG + Intergenic
903978031 1:27164315-27164337 AAGAAAATTTAAAAGTATAAAGG + Intronic
905157399 1:35996972-35996994 AAGTACTTTGAAAAATAGTTTGG + Intronic
906245726 1:44272508-44272530 AAAAACCTGGAAAAATAGTATGG - Intronic
906382017 1:45338922-45338944 AAGAAAATTAAAAATTAGTTGGG - Intronic
907066703 1:51491551-51491573 CAGAAGAATGAAAAATAGTAAGG + Intronic
908014812 1:59820071-59820093 AAAATCACTGAAAAGTAATAAGG - Intronic
908079271 1:60558230-60558252 AAGAATAGTGAACAGTAGTGAGG - Intergenic
908143243 1:61209856-61209878 AAAAAAATTAAAAAGTAATATGG + Intronic
908330369 1:63064954-63064976 AAGCACTGTGAAAACTAGTATGG + Intergenic
908504239 1:64779527-64779549 AAAAAAATTAAAAAGTAGTTGGG - Intronic
908697684 1:66863029-66863051 AAGAAGCTTGTATAGTAGTACGG + Intronic
908779410 1:67675754-67675776 AAGAACAAAGAAAATTAGAAAGG + Intergenic
908881828 1:68741475-68741497 AACAAAGTTGAAATGTAGTAAGG + Intergenic
909162678 1:72173594-72173616 AATAACAATGAAAAGATGTAAGG - Intronic
909621720 1:77675342-77675364 AAAAACTTTAAAAACTAGTAAGG + Intronic
909687358 1:78365201-78365223 AGGAACATAGAAAAGAAGAAGGG - Intronic
910166332 1:84331697-84331719 AAGAAAATTGAAAACTGATAAGG + Intronic
910433842 1:87185159-87185181 AAGAACAATGAGAAGCAGAAGGG - Intergenic
911036170 1:93550838-93550860 AGGTACATTGAAATCTAGTAGGG + Intronic
911147186 1:94563691-94563713 ATGAACATAGAAAAGTATAATGG + Intergenic
911247367 1:95533666-95533688 AAGGAGATTGAAAAGTATTTTGG - Intergenic
911688786 1:100807840-100807862 AAGAACACTGAAAGATAGTGTGG + Intergenic
911834701 1:102602264-102602286 AAGAATATTTAAAAGAAGCATGG - Intergenic
913313606 1:117530354-117530376 AAGAAAATTGAGATTTAGTAGGG - Intergenic
914698530 1:150108580-150108602 AAGGATACTGAAAAGTAGCAAGG + Intronic
916383380 1:164238732-164238754 AAGTACATAGAGAAGTAATAAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916765224 1:167853789-167853811 AAGAACATTGACAAATCTTAAGG - Intronic
917032619 1:170710660-170710682 AAGACCTTTGAAAGGTAATAAGG + Intronic
917424841 1:174902788-174902810 GAGAACAAAGAAAAGTAGTGTGG - Intronic
917752422 1:178065994-178066016 AAAAAAATTGAAAATTAGTTGGG + Intergenic
919147304 1:193651728-193651750 AATAAAGTTGAAAAGTAGTCTGG - Intergenic
919429484 1:197474852-197474874 AAGATCATTGGATAGTACTAAGG + Intronic
919444283 1:197682564-197682586 AGGAAAATTGAAAAATAGTAGGG + Intronic
920014569 1:202896095-202896117 AAGAACCTTAAAAGGTAGGAGGG + Intronic
920593594 1:207246680-207246702 CAGAATATTAAAAATTAGTAAGG - Intergenic
921942995 1:220863019-220863041 AAGAACCTTGAAAAATGGTTAGG - Intergenic
923634549 1:235682148-235682170 AAAAAATTTAAAAAGTAGTAGGG + Intronic
924391019 1:243557423-243557445 TATAACATTGAAAAGAAGTTAGG + Intronic
1062784356 10:250070-250092 AAGAACATGGAAAAGTTATTCGG - Intronic
1064163923 10:12970971-12970993 ATGAACGTTGAGAAGTAGAAGGG - Intronic
1064452879 10:15459167-15459189 AAGAACATAGAAAGGAAGAAAGG - Intergenic
1065401019 10:25301423-25301445 GAGAACATTGAACTGTAATAAGG - Intronic
1065546007 10:26821347-26821369 AAAAACATAGAAAATTAATAAGG + Intronic
1065610804 10:27469123-27469145 AAGAACATTGAGAAGGTGAAAGG - Intergenic
1066063855 10:31748322-31748344 AAAAACATTGAAAACTGGAAGGG + Intergenic
1066553418 10:36584582-36584604 AAGAAGGATGAAAAGTAGGAAGG - Intergenic
1066604413 10:37146221-37146243 AATAAAATGAAAAAGTAGTAAGG - Intronic
1068231906 10:54178612-54178634 AAGAACAATGAAAAGAAGTGGGG + Intronic
1068743491 10:60501824-60501846 AAGAAAATTGAAAAATAGCCAGG + Intronic
1069477378 10:68746557-68746579 AATAACAATAAAAAGTAGTTGGG - Intronic
1070151788 10:73809891-73809913 AAAAAAATTAAAAATTAGTAGGG - Intronic
1072416717 10:95252834-95252856 AAGATCATAGAAAAATAGAATGG + Intronic
1072812426 10:98473187-98473209 AAGAAAATTGAAAGGTGGTCAGG + Intronic
1074091492 10:110262957-110262979 AATAACAGTATAAAGTAGTATGG - Intronic
1074551794 10:114450369-114450391 AATAACATTGAAAATGCGTAAGG - Intronic
1075757809 10:124828932-124828954 AATAACATTTAAAAGGTGTATGG + Intronic
1075837289 10:125465436-125465458 AATAACAATCAAAAGTAATACGG - Intergenic
1076454725 10:130582335-130582357 AAAAAAAATGAAAAGGAGTAAGG - Intergenic
1077649391 11:3956380-3956402 AAGCACCTGGAAAAGTAGGAAGG + Intronic
1078746562 11:14120989-14121011 AAGACAATTGAAAAGAAGGAGGG + Intronic
1079552148 11:21713057-21713079 AAAAACACACAAAAGTAGTAAGG + Intergenic
1079565887 11:21881640-21881662 AAGGACATTAACAAGGAGTAAGG + Intergenic
1079640616 11:22800325-22800347 AAGATCCTGGGAAAGTAGTAGGG - Intronic
1079877757 11:25881103-25881125 AAGAACCCTGAAAAGGAGTTTGG + Intergenic
1083044229 11:59718405-59718427 AACAACACTGTAAAGTAGTGAGG - Intronic
1083340664 11:61956490-61956512 AAAAACATTAAAAATTAGCAGGG + Intronic
1083735959 11:64681440-64681462 AAGAACATAGCAAAGAAGGAAGG + Intronic
1084986396 11:72876713-72876735 AAGAATATAGAAAATCAGTAAGG - Intronic
1085137926 11:74110653-74110675 AAGAACATACCCAAGTAGTAAGG - Intronic
1085576172 11:77605752-77605774 AAGAACATTAAAAAGTAGCCAGG + Intronic
1086682806 11:89695565-89695587 AAAAACATCTAAAAGTAGGATGG + Intergenic
1086864931 11:91969547-91969569 AAGAAGATTGAGCAGTGGTAGGG - Intergenic
1087359635 11:97142027-97142049 TAGAACATGGAAAATTATTAGGG - Intergenic
1088010886 11:104999542-104999564 AAGAACACTGAAAAATAACAAGG - Intronic
1088556503 11:111066551-111066573 AAGAACATTGTCAAGTAGAGAGG + Intergenic
1088687137 11:112294220-112294242 AAGAACACTTACAAGTAGTAAGG + Intergenic
1089348128 11:117804767-117804789 AAAAACATTTAAAAGTAGCCAGG + Intronic
1089856504 11:121549859-121549881 AATAAAAGTGAAAAGTAGTAAGG + Intronic
1090638494 11:128709221-128709243 AATAAGAATCAAAAGTAGTATGG + Intronic
1090651653 11:128811725-128811747 CAGAACTTGGAAAAGTTGTAGGG + Exonic
1091132463 11:133157999-133158021 CAGAAAATTGAAAAATAATAGGG + Intronic
1091270449 11:134307965-134307987 AAAAACATTGAAAAATACTTGGG + Intronic
1091927171 12:4362419-4362441 AACAACAATAAAAAGTAGCATGG - Intergenic
1092512087 12:9167555-9167577 GAGAACAATGAAAAGCAGCAGGG - Intronic
1092512272 12:9170144-9170166 GAGAACAATGAAAAGCAGCAGGG + Intronic
1093575506 12:20723200-20723222 AAGTACATTGAGCAGCAGTATGG + Exonic
1093892843 12:24544433-24544455 AAGAACATTCAAAAGCATTCTGG + Intergenic
1094467430 12:30768487-30768509 AAGAACATTCCAATGTAGAAAGG - Intergenic
1094621033 12:32080451-32080473 AAGGACATTGACAAGTAACAAGG + Intergenic
1094651183 12:32377336-32377358 AAGAAAAATGAAATGTATTAAGG - Intronic
1094794289 12:33952485-33952507 AATAATATTGAAAATGAGTAAGG - Intergenic
1097986305 12:65786376-65786398 AAGAAAAATGAAAAGAAGGAAGG - Intergenic
1098052800 12:66472258-66472280 ATGCACATTGAAAGGTAGTGGGG + Intronic
1098493659 12:71110646-71110668 AAGAAAATTGAAATGCAGTGAGG - Intronic
1098951229 12:76642446-76642468 AAAAATCTTGAAAAGGAGTAGGG - Intergenic
1099128049 12:78791104-78791126 AAGAAGAAAGAAAAGTAGCATGG + Intergenic
1099409144 12:82303128-82303150 AAGAACACTGGAAAGGAGTTTGG + Intronic
1099480671 12:83161995-83162017 AAGAATATTGAATAGTAGAAAGG + Intergenic
1099548534 12:84014079-84014101 AATAAACTTGAAAAGTAGTCTGG - Intergenic
1100353230 12:93804520-93804542 GAGAACAATGAAATGTAGTGCGG + Intronic
1100546888 12:95611918-95611940 AAGACCTTAGAAAAGTGGTAGGG + Intergenic
1100633020 12:96407138-96407160 AGGAACATTGCATAGTAATAGGG + Intergenic
1101003166 12:100376427-100376449 AAGATCATTGAGAAGGAGCATGG + Intronic
1101130421 12:101685324-101685346 ATGAAGATTGAACAATAGTAGGG + Intronic
1101148314 12:101862660-101862682 TACAACTTAGAAAAGTAGTATGG + Intergenic
1101226247 12:102690853-102690875 AAGAACAAGGTAAAGAAGTATGG - Intergenic
1101292099 12:103381229-103381251 AAGAACCATGAGAAGTAGGAAGG - Intronic
1101693354 12:107101593-107101615 AAGAATATTCAAAAGTACTGAGG - Intergenic
1103171775 12:118826896-118826918 AAAATCCTTGAAAAGTAGTATGG + Intergenic
1104134792 12:125927029-125927051 AAGTAGATTGAAATGTAGGAAGG + Intergenic
1105057788 12:133118801-133118823 AGGAACATAGAAAAAAAGTATGG - Exonic
1105908061 13:24834064-24834086 TGGAACATTGAAAAGTAGCCAGG + Intronic
1106893575 13:34273174-34273196 AAGAACATTGGGAAGTAGAGTGG + Intergenic
1106958869 13:34974154-34974176 AAGAACAATGAAAAGCAGATAGG - Intronic
1107734300 13:43381000-43381022 AAGTACATAGAAAATCAGTAAGG + Intronic
1108976071 13:56444554-56444576 GAAAAGATTGAAAAGAAGTAAGG + Intergenic
1109074953 13:57822899-57822921 AAGAAACAAGAAAAGTAGTAAGG - Intergenic
1109093340 13:58076499-58076521 GAGAACACTGAAAATTAGAAAGG - Intergenic
1109283983 13:60390175-60390197 AAAAAAATTGAAAATTAGTCAGG - Intergenic
1109628048 13:65004417-65004439 AAGAACATTTATAAATAGTGTGG - Intergenic
1109711037 13:66160811-66160833 AAGAAAAATGAAAGGTAGGAGGG + Intergenic
1109765577 13:66891586-66891608 AAGAGCATTTAAAAGTAGCTTGG + Intronic
1110136087 13:72068686-72068708 AAGAAAATTAGAAAGCAGTATGG + Intergenic
1110536956 13:76661656-76661678 ATGAACAAAGAAAAGTGGTAAGG + Intergenic
1110665846 13:78116563-78116585 AAGAAACTTGAAAAGCAGTCTGG - Intergenic
1110924536 13:81133728-81133750 AACAATTTTGAAAAGTAGTTTGG + Intergenic
1111047263 13:82830094-82830116 AAGAACATTTTATAATAGTATGG - Intergenic
1111423498 13:88048992-88049014 AAGACAATTGAAAAGTAATGGGG + Intergenic
1111894638 13:94126220-94126242 AAAAAAATTGAAAATTAGTTGGG + Intronic
1114780761 14:25536083-25536105 CAGAACATGGAAAACTATTAAGG + Intergenic
1114867508 14:26614930-26614952 TAGGTCATTAAAAAGTAGTAGGG - Intergenic
1115253175 14:31370512-31370534 AAGAACACTGAAAAATAATTTGG + Intronic
1115619262 14:35125019-35125041 AAGAAAATAGAAAATTAGCAGGG - Intronic
1116242465 14:42362870-42362892 AAGAAAAATTAAAAGTAGTCAGG - Intergenic
1116343582 14:43758248-43758270 AATAACATTTGAAAGTAGAAAGG + Intergenic
1116410992 14:44623772-44623794 AAAAAAATTGGAAAGTAGAATGG + Intergenic
1116500276 14:45612551-45612573 ATGAAGATTGGAAAGTAGGAAGG + Intergenic
1117471752 14:56053325-56053347 AATGATTTTGAAAAGTAGTATGG + Intergenic
1117710325 14:58521718-58521740 AAGAAAATTGAAAAGGAACAGGG + Intronic
1117873999 14:60231949-60231971 AATAACATTGCAAAGGAGAAAGG - Intergenic
1121795010 14:96727595-96727617 AAGAAAATTGAAAAGTCGAGAGG + Intergenic
1122948325 14:105024839-105024861 AAGAAAAAAGAAAAGTATTAAGG + Intergenic
1202836066 14_GL000009v2_random:77953-77975 AACAAAATTTAAAAGTATTAAGG - Intergenic
1125117976 15:36118139-36118161 CAGAAAATAGAAAAGAAGTAAGG - Intergenic
1125145123 15:36458135-36458157 AAGAACATTGAATAGAATTTGGG - Intergenic
1125398769 15:39278096-39278118 AAGAACATTGCCAAGGGGTATGG - Intergenic
1126147751 15:45492969-45492991 AAGTACATTTAAAAACAGTAAGG + Intronic
1128039385 15:64557293-64557315 GAGAACATTGAAAAATAATCAGG + Intronic
1129149242 15:73677312-73677334 AAGAACTTGGAAAAGGAGTAGGG + Intergenic
1130967430 15:88707731-88707753 AAAACCTTTGAAAAATAGTATGG - Intergenic
1132051395 15:98610550-98610572 AAAAACGTTGAAAAGTACAAAGG - Intergenic
1134389386 16:13805265-13805287 AAAAACTATGAAAAGAAGTAAGG + Intergenic
1135030707 16:19036095-19036117 AATAACAGTGTAAAGTAGCAGGG - Intronic
1136377758 16:29875623-29875645 AAGAAAATTGAAGAGCAGAAAGG - Intronic
1137756937 16:50909936-50909958 CAGAACATTGAAATCTAATATGG - Intergenic
1138303383 16:55951678-55951700 AAGAACAATGAAAGAAAGTAGGG + Intronic
1140619538 16:76712233-76712255 GAGAACATTTAAAATTAGAAAGG - Intergenic
1142214731 16:88824996-88825018 AAGATGATTGAAAAGTAAAAAGG + Intronic
1142814702 17:2415994-2416016 AAAAACATTAAAAAGTCGAAAGG + Intronic
1143116303 17:4583732-4583754 AAGAGCATTGAGAAGGAATAGGG + Intergenic
1148404843 17:47402153-47402175 AAGAATTTGCAAAAGTAGTAAGG + Exonic
1149125748 17:53229629-53229651 AATAACATAGAAAAGAAGTTGGG + Intergenic
1149150309 17:53554086-53554108 AAGAACAATGGAAAGAATTAAGG + Intergenic
1150150227 17:62803126-62803148 AAGAAAATTGAAAATTAGCCAGG + Intronic
1150548693 17:66189517-66189539 AAGTATTTTGAAAAGTAGAAAGG + Intronic
1150550417 17:66204531-66204553 AAGAAGATGGAAGAGTAGGAAGG + Intergenic
1150858139 17:68772940-68772962 AAGAAATTTGAAAAGTAAAAGGG - Intergenic
1150903166 17:69305708-69305730 AAAAAAATTGAAAATTAGTTGGG + Intronic
1152668579 17:81587170-81587192 AAGAACATTAAAAGTTAATATGG + Intronic
1152991872 18:371022-371044 AGGAACATTGCATAGTAGTGAGG - Intronic
1154477755 18:14781164-14781186 AATAAAATGAAAAAGTAGTAAGG - Intronic
1155015502 18:21834815-21834837 AAGAACATTGAATAAAACTAAGG + Intronic
1155719178 18:28989651-28989673 GAGAACATTCAAAAGTAAGATGG - Intergenic
1155768215 18:29664000-29664022 AAGAAAACTGAAAAGAGGTATGG + Intergenic
1156532728 18:37833994-37834016 AAAAATAGTGAAGAGTAGTAAGG + Intergenic
1156745642 18:40388137-40388159 AACAACATAGAAAATTAGTGAGG + Intergenic
1156835746 18:41552303-41552325 AAGAACCTTGAAAAGTAGGAAGG + Intergenic
1157082535 18:44541759-44541781 AAGAACCTGGAAAAATAGTAAGG + Intergenic
1157632209 18:49109484-49109506 AAGAACTGTGAAAAGTGATATGG + Intronic
1159456058 18:68661331-68661353 AAGGACAGTGAAGAATAGTATGG - Intergenic
1159456075 18:68661488-68661510 AAGGACAGTGAAGAATAGTATGG - Intergenic
1160458124 18:79017294-79017316 AAATACTCTGAAAAGTAGTAAGG - Intergenic
1161019101 19:1999503-1999525 AAAAACATTGAAAATTAGCCAGG + Intronic
1162596059 19:11630195-11630217 AAGAAACTTGAAAGGTAGTCAGG + Intergenic
1163734397 19:18970227-18970249 AAAAACTTTGAAAAGTAGCCGGG + Intergenic
1164530913 19:29047579-29047601 AATAAAAATGAAAAGTAGAAAGG - Intergenic
1165378858 19:35463588-35463610 AAGAACATTGACAAAGAGTTTGG - Intergenic
1166625334 19:44346975-44346997 AAGAAGACTGAAAACCAGTAAGG - Intronic
1167294526 19:48641803-48641825 AAGAAAATTGAAAATTAGTTGGG - Intronic
1168696449 19:58406529-58406551 AGGAACATAGAAAAGTGGCAAGG + Intronic
925491399 2:4399045-4399067 AAGTATATTAAAAAGAAGTATGG - Intergenic
925578735 2:5387570-5387592 AAGAAGATTTAAAAGGAATAGGG - Intergenic
926989170 2:18658665-18658687 AAGAAGATTAAAATTTAGTAGGG - Intergenic
927818633 2:26243429-26243451 TAGAACATTGAAATGCTGTAAGG - Intronic
928189081 2:29145001-29145023 AAGAACATTAAATAATAATAAGG - Intronic
928302122 2:30134653-30134675 GAAAACATTGAGAAGTATTAGGG - Intergenic
928793217 2:34984308-34984330 AAGCACATTTTAAAATAGTAAGG - Intergenic
929183660 2:39070400-39070422 AAGGACATGGAAAAGGAATAAGG - Intronic
929416790 2:41751108-41751130 AACAACCGTGAAAAGTATTATGG + Intergenic
929950285 2:46404852-46404874 AAGAACATTAAAAAGAAGAGAGG - Intergenic
930436726 2:51353676-51353698 ACATACAATGAAAAGTAGTAAGG - Intergenic
931443756 2:62309467-62309489 AAGAGCATAGACCAGTAGTAGGG + Intergenic
931925982 2:67073100-67073122 AAGAACATTCTAAAGTGGGAAGG + Intergenic
933016466 2:77134003-77134025 ACTAACATTGAAAATTAGCAAGG + Intronic
933055074 2:77652403-77652425 AATAGCATTGTAAAGTAGCAGGG + Intergenic
933174944 2:79164504-79164526 AAGGACCTTGAAAAGTGGTCAGG - Intergenic
933429781 2:82161432-82161454 AAGAAAGGTTAAAAGTAGTAAGG - Intergenic
935495723 2:103778541-103778563 AAGAAAAGTTGAAAGTAGTAAGG - Intergenic
935504078 2:103877865-103877887 TAAAACATTGAAAAATAATAGGG + Intergenic
935523119 2:104134315-104134337 AGGAACAGTGGAAAGGAGTAAGG + Intergenic
935725147 2:106017576-106017598 AAGAACATTAAAAATTAGCTGGG - Intergenic
938282403 2:130073807-130073829 AACAAAATTAAAAAGTATTAAGG + Exonic
938333033 2:130462379-130462401 AACAAAATTAAAAAGTATTAAGG + Exonic
938356776 2:130658292-130658314 AACAAAATTAAAAAGTATTAAGG - Intergenic
938433212 2:131265098-131265120 AACAAAATTAAAAAGTATTAAGG - Exonic
939122227 2:138131209-138131231 AGGAACTCTTAAAAGTAGTAAGG + Intergenic
939791298 2:146580977-146580999 AAGATCACTTAAAAGTAGAATGG - Intergenic
940424964 2:153520677-153520699 AAGAGAAATGAAAAGCAGTAGGG - Intergenic
940552870 2:155183751-155183773 GACAACATTGAAAAGTAGCTAGG - Intergenic
941059758 2:160833114-160833136 AAGAATATTGAAAAGTACAGGGG + Intergenic
942347341 2:175017187-175017209 AATAAAATTGATAAGTAGTGGGG + Intergenic
942515959 2:176753446-176753468 AAGAACCTTGTGAAGTAGGAAGG + Intergenic
943235251 2:185309496-185309518 AAAAAAATTAAAAAGTAGAATGG - Intergenic
943428925 2:187773375-187773397 AAGTACATTGAAATGTGGAAGGG + Intergenic
943556539 2:189412954-189412976 AAGAGAATGGAAAAGTTGTATGG + Intergenic
943904573 2:193481530-193481552 AATAACATTTAAAATTATTATGG + Intergenic
944620893 2:201515117-201515139 AAAAAAATTAAAAACTAGTAGGG + Intronic
947292109 2:228587179-228587201 AAGGACATTGAAAAGCATTTTGG - Intergenic
947326428 2:228983697-228983719 AAGAACCTTGATATATAGTATGG - Intronic
947467729 2:230368631-230368653 AAAAAGAATGAAAAGTAATAAGG - Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
947737057 2:232460565-232460587 GAGAACATTGAAAAGAATAAAGG + Intergenic
947955784 2:234189575-234189597 GAGAACTCTGAAAAGCAGTATGG + Intergenic
1169052287 20:2590624-2590646 ATTAATATTGAAAAGTAGTAGGG - Intronic
1169307493 20:4504908-4504930 ATGAATATAGAAAAGTAATAAGG + Intergenic
1170269957 20:14515078-14515100 AAGAGCATTCAAAAGTATTCTGG + Intronic
1171169730 20:23005094-23005116 AAGAACAATGAGAAGGATTAGGG + Intergenic
1173257459 20:41405054-41405076 AAGCACAACGAAAAGTGGTACGG - Exonic
1174567567 20:51477178-51477200 AAGCACTTTAAAAAATAGTAAGG + Intronic
1174584537 20:51597793-51597815 AAATACATTAAAAAGTAGCATGG + Exonic
1174815462 20:53683388-53683410 AAAAACAATGAAAATTAGCAGGG + Intergenic
1176154755 20:63613192-63613214 AAGAACAGTGAGAAGTAGAGAGG - Intronic
1176907134 21:14515124-14515146 AATACAGTTGAAAAGTAGTAAGG + Intronic
1177066084 21:16438238-16438260 GAGAAAATTGAAAATTAGTTAGG + Intergenic
1177080502 21:16633357-16633379 AAGAAAACTGAAAAGAAGCATGG - Intergenic
1177419850 21:20842483-20842505 TAGAAAATTGAACAGTTGTAGGG + Intergenic
1177592275 21:23185768-23185790 AAGAACAGAGAAAAGTGGGAAGG + Intergenic
1177871162 21:26574239-26574261 AATATCAATGTAAAGTAGTAGGG + Intergenic
1177922730 21:27172881-27172903 AAAAAAATTGAAAAGTAGCTGGG - Intergenic
1178132217 21:29586531-29586553 AAAAAGATTGAAAACAAGTAGGG + Intronic
1178564531 21:33671086-33671108 AGAAACATTCAAAAGTCGTATGG + Intronic
1178869081 21:36357399-36357421 AAAAAAATTGAAAAGTACGATGG - Intronic
1179393400 21:41014672-41014694 AAGAAGATTCAAATGTAGAATGG + Intergenic
1181006879 22:20017642-20017664 AAGAAAATGGGACAGTAGTACGG - Intronic
1182980332 22:34664683-34664705 AAGAACATTTAACATTAGAAAGG + Intergenic
1184931422 22:47683972-47683994 AAGAACGTTGAAAAATGGGAAGG - Intergenic
949574048 3:5321548-5321570 AACAACATCCAAAAGTAGGAAGG - Intergenic
949714056 3:6907652-6907674 AAGAAGAATGAAAAGAAATAAGG + Intronic
949907742 3:8872815-8872837 ATGAACAGTGAAAAGTAGCAAGG + Intronic
951794476 3:26523499-26523521 AAGAAGAGTGAAGAGTAGGAAGG - Intergenic
951924077 3:27887958-27887980 AATAAAAGTGAAAAGTAGTAGGG - Intergenic
952338535 3:32425675-32425697 AACAACATTAAAATGTAGAAAGG + Intronic
952671259 3:35972308-35972330 ATGAACAAAAAAAAGTAGTAAGG - Intergenic
953402197 3:42633837-42633859 AAGCACATTGAAAGATAGTATGG + Intronic
956406121 3:68931215-68931237 AAGACCATTGAAAAGTTAAAAGG + Intronic
958136007 3:89492585-89492607 AAGAGCAAAGAAAATTAGTAGGG - Intergenic
959019947 3:101177906-101177928 AACAAGATTGCAAACTAGTATGG - Intergenic
959535276 3:107477711-107477733 AAAAAAATTAAAAAGTATTACGG + Intergenic
959569780 3:107870720-107870742 AAGAAAATTAAAAAGAAGGAAGG - Intergenic
959772948 3:110121887-110121909 AAGAAAATTAAAAAGTACTTTGG - Intergenic
959999746 3:112718406-112718428 AACAAATTTGAAATGTAGTAGGG + Intergenic
960337134 3:116431824-116431846 AAGAAAATAGAAATTTAGTATGG + Intronic
960381778 3:116971383-116971405 GAGAACTTTGAAAAGTAGGAAGG + Intronic
960446430 3:117754880-117754902 AAGAAGAATGAAAAATATTAAGG - Intergenic
961004312 3:123394633-123394655 GATAACACTGAAAAGTGGTAAGG + Intronic
961228531 3:125277925-125277947 AATAACATTAAAAATTTGTATGG - Intronic
962313726 3:134344880-134344902 AAGAAGATTGAGAAGTTTTATGG - Intergenic
963396935 3:144746956-144746978 AAAATCCTTGAAAAGTAGTCTGG + Intergenic
964952005 3:162307350-162307372 AAGAAGAATGAAAAATAGTGAGG - Intergenic
965014429 3:163139130-163139152 AAGAAGAAAGAAAAGTAGTAAGG - Intergenic
965242715 3:166224368-166224390 AAGAAAATTAAAATGTGGTATGG + Intergenic
966030788 3:175345339-175345361 AATAATATTAAAAAGAAGTAAGG + Intronic
966042851 3:175512681-175512703 AAGAAAATTGTATAGTAGTTCGG - Intronic
966846113 3:184131139-184131161 AAGAAAAATGAAAAAAAGTATGG + Intergenic
967107876 3:186268757-186268779 AAAAACGTTGAAAAGAAGCAGGG + Intronic
967543848 3:190700269-190700291 AAGAAAATTAAAATGTAGGAAGG - Intergenic
968040199 3:195582257-195582279 AAGGACATTGAAAACTATAATGG - Intronic
972695649 4:41443452-41443474 AAACACATTTAATAGTAGTATGG + Intronic
973025434 4:45263561-45263583 AAGACTGTTGAAAAATAGTAAGG + Intergenic
973394227 4:49579655-49579677 AACAAAATTTAAAAGTATTAAGG - Intergenic
973783148 4:54309192-54309214 AATAACATTGAAGAATAGTTAGG - Intergenic
974419246 4:61650973-61650995 AAGAATAATGGAAAATAGTAAGG + Intronic
974473550 4:62350908-62350930 AGAGAGATTGAAAAGTAGTAAGG - Intergenic
974485346 4:62496856-62496878 AAGAACATTGAAAATTAGCCAGG - Intergenic
974678127 4:65123040-65123062 GTGAACATTGAAAAGTGGAAAGG + Intergenic
975189059 4:71438408-71438430 AGGAACCTTGTAAAGTAGTTAGG - Intronic
976997977 4:91460225-91460247 AAGAATATTGATAATTCGTAGGG + Intronic
977392304 4:96427182-96427204 TAGAACTATGAAAAGTTGTAGGG - Intergenic
978631809 4:110756299-110756321 CAGAAACTTGAAACGTAGTAAGG + Intergenic
978711113 4:111782338-111782360 AAGAACATTGGAAACAAGTGTGG + Intergenic
979029747 4:115628071-115628093 AAGCAAATTGCAAAGTAGGAAGG - Intergenic
979034912 4:115703445-115703467 AAGAATGATGAAGAGTAGTATGG - Intergenic
979100603 4:116607545-116607567 GAGAAAATTGTAAAATAGTAGGG + Intergenic
979527669 4:121734566-121734588 AAGAAAACTGAAAAGTATTCAGG + Intergenic
980076353 4:128297881-128297903 AAAAACATTGAATACTAGAAAGG + Intergenic
980193318 4:129554372-129554394 AATAACAATGAAAAATATTAAGG - Intergenic
980447964 4:132936633-132936655 AAGAAGATTGAGAAGTACTAAGG - Intergenic
981278448 4:142929317-142929339 AAGAACATTGAGAAGAAGAGAGG - Intergenic
981413286 4:144458338-144458360 AAGAACACCAAAAAGTAGAAGGG - Intergenic
981576178 4:146208232-146208254 AAGAACATTTAAAAATTGTAAGG - Intergenic
982680650 4:158424917-158424939 AATAACAAGGACAAGTAGTATGG + Intronic
983178512 4:164619849-164619871 AATAATATTGAAAATTAGTATGG - Intergenic
983501027 4:168499834-168499856 AAAAACATTGACAGGCAGTAAGG - Intronic
983508178 4:168578000-168578022 AAGAACATTGAAAAGTAGTATGG - Intronic
984287506 4:177751313-177751335 AAGAACATCCAAAAATAGAAAGG - Intronic
1202763888 4_GL000008v2_random:135281-135303 AACAAAATTTAAAAGTATTAAGG + Intergenic
986452771 5:7882540-7882562 AGGAATATAGAAAAGGAGTAGGG + Intronic
987176622 5:15317782-15317804 AAGAGCATTGAAAAATACCAGGG + Intergenic
988111646 5:26830439-26830461 CAGAACATTGAAAATTAGGTGGG - Intergenic
988435926 5:31175313-31175335 AAGCACTTTGAAATGAAGTAAGG - Intergenic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989490344 5:42044910-42044932 TATAATATTGAAAAGCAGTAGGG - Intergenic
990113724 5:52362063-52362085 AAGAATGTTGAAAATTAATATGG + Intergenic
990131316 5:52589395-52589417 AATAACATTAAAAAGAAGTAGGG - Intergenic
990373521 5:55145699-55145721 AAGAACCTCCAAGAGTAGTAGGG - Intronic
991911707 5:71569444-71569466 AAAAACATTAAAAAATAATAGGG + Intergenic
991985864 5:72286296-72286318 AAGAACATGCAAAAGTTGAAGGG + Intronic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994316620 5:98340236-98340258 AACAAAATTAAAAAGTATTAAGG - Intergenic
994571684 5:101523982-101524004 CAGAACATCGAAAAGTACCAGGG + Intergenic
994702528 5:103154433-103154455 AAAAACTTTGAAAAGTAGTATGG + Intronic
994901115 5:105770688-105770710 AAGAAAATTCAAAAGTAGGTTGG + Intergenic
996529508 5:124512838-124512860 AAGAAAATAGAAAAGGAGCATGG + Intergenic
996822778 5:127649001-127649023 ATTAACATTCAAAAGGAGTACGG - Intergenic
998981531 5:147708631-147708653 AGGAACATTGAAATGTGGTAGGG - Intronic
999567335 5:152879156-152879178 AAAAAAATTAAAAAGTAGAAAGG + Intergenic
1000383850 5:160655053-160655075 ATGAACATAGAAAAGAAATAGGG - Intronic
1000882103 5:166710303-166710325 AATATCTTTGAAAAGAAGTAGGG - Intergenic
1000909093 5:166999394-166999416 AACCACATCGAAAAGTAGTGGGG + Intergenic
1001188312 5:169599933-169599955 AAGAACAATGAAACATATTAGGG + Intronic
1001461805 5:171922356-171922378 AAGAACAATGAAAAGCTGTTTGG - Intronic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1004013838 6:11714364-11714386 AGGAACATAGCAAAGTAGGAGGG - Exonic
1006767190 6:36517619-36517641 GAGCACATTTAAAAGTAGAAAGG + Intronic
1008832087 6:55777543-55777565 AAGAACATTAAAATAAAGTATGG + Intronic
1009882368 6:69584356-69584378 AAGAACAATGGAAAGAAGGAAGG + Intergenic
1010009276 6:71031420-71031442 AATATCATTGAAAAGCAATAAGG - Intergenic
1010375933 6:75170106-75170128 AAGAAAATGGAAAAGGGGTAAGG - Intronic
1010984483 6:82407971-82407993 AAGAACATGGACAAGAAGCAAGG - Intergenic
1011078189 6:83460666-83460688 AAAAATTTTAAAAAGTAGTAGGG - Intergenic
1011357760 6:86490010-86490032 ATGAACATTGAAAATGAATACGG + Intergenic
1012076753 6:94697261-94697283 AAGAACAGTGAACAGTTTTAGGG - Intergenic
1012411205 6:98959584-98959606 AAGAACATGGAATAGAAGTGTGG - Intergenic
1012439043 6:99245207-99245229 AAGAATTTTGAAAGGTAGAATGG + Intergenic
1012874534 6:104710989-104711011 AAGAACAATGAAAGGTATTTTGG - Intergenic
1013140716 6:107331454-107331476 AAGAACTTTGGAAAAGAGTAGGG - Intronic
1013915055 6:115326898-115326920 AATAATATTTATAAGTAGTAAGG + Intergenic
1014067272 6:117142186-117142208 GAGAACATTGAAAAGTTACATGG + Intergenic
1014148695 6:118028359-118028381 AAGATCAATGAAAATGAGTAGGG + Intronic
1014452905 6:121602263-121602285 AAGTATGTTGGAAAGTAGTAGGG - Intergenic
1014801893 6:125787755-125787777 AAGAACAGTGAAAAGTGTTAGGG + Intronic
1015008160 6:128309923-128309945 AATAAGATTGAAAAATAATATGG + Intronic
1015480770 6:133706064-133706086 AAAAAAATGGAAAAGTAGAATGG + Intergenic
1015991424 6:138948298-138948320 AACAACATGGAAAAATACTAAGG + Intronic
1016545896 6:145223670-145223692 AAGAATATTGAAAAATAACATGG - Intergenic
1016714271 6:147204868-147204890 AAAATCAATGAAAAGGAGTAAGG - Intronic
1017943367 6:159073252-159073274 AAGAACATAGAAAAGGGGTGAGG - Intergenic
1018051387 6:160011890-160011912 AAGAACTTTCAAAGGTTGTAAGG + Intronic
1018912874 6:168113604-168113626 CAGAACAATGAAAGGTAGTTAGG + Intergenic
1019965236 7:4493388-4493410 TATAAAATTGAAAAGTAGTTTGG + Intergenic
1020408824 7:7867724-7867746 AAAAACATAGAAAGATAGTATGG + Intronic
1021278461 7:18685915-18685937 AACAACAATGAAAGGTAGTAGGG + Intronic
1021792949 7:24224755-24224777 CAGAACTTTGAAAATTAATAAGG + Intergenic
1021809548 7:24390093-24390115 AGGAACAGTAAAAAGTAGTAGGG - Intergenic
1022712738 7:32866846-32866868 AAGAAAAGAAAAAAGTAGTAAGG + Intergenic
1022840177 7:34156978-34157000 GAGAAACTTGAAAAGTAGGAAGG + Intergenic
1023325977 7:39057220-39057242 AAAAGCATGCAAAAGTAGTAAGG - Intronic
1023621769 7:42080656-42080678 ATGAAGAATGAAAAGCAGTATGG + Intronic
1024352387 7:48380093-48380115 AATAAGATTGAAAACTAATAGGG + Intronic
1024479084 7:49845484-49845506 AAAAACACTGAAATGTAGAATGG + Intronic
1026103728 7:67404031-67404053 AAGATGAATGAAAAGTAGGAAGG - Intergenic
1026332546 7:69365140-69365162 AAAAGCATTGAAAAGTGGTTGGG - Intergenic
1026367006 7:69658522-69658544 CAGAACCTAGAAAAGTAATAAGG - Intronic
1027689352 7:81322754-81322776 AAGAAGATAGAAAAGAAGGAGGG - Intergenic
1027716549 7:81678544-81678566 TAGAGAATTGAAAAGAAGTAGGG + Intergenic
1028172743 7:87618181-87618203 AAGAACATATAAAAGAAGTTGGG - Intronic
1028298409 7:89165438-89165460 AAGAAAATTGCAAAGCAGAATGG + Intronic
1028603962 7:92634610-92634632 AGGAAGATTGAATAGTTGTAAGG - Intronic
1030082504 7:105789748-105789770 AAGAACAATGAGAAGTACTGGGG + Intronic
1030788358 7:113691306-113691328 AAGAAAATTAAAAAGTAGAGTGG - Intergenic
1031323356 7:120361653-120361675 TAGAACTTTGAAAAGCAGAAAGG + Intronic
1031957472 7:127957057-127957079 CAGAACATTGAATAGTAGACTGG - Intronic
1032763596 7:134968229-134968251 AAGAAAAATGAATAATAGTATGG - Intronic
1033267573 7:139899226-139899248 AAGCACATTGTAAAATAGTATGG - Intronic
1033966667 7:146983575-146983597 AAGAAGATTCAAATGTAATATGG - Intronic
1034781977 7:153888757-153888779 CAGAACCTTCAAAAGTAGCAAGG - Intronic
1034891200 7:154840735-154840757 AAGATCATTGAAATGAAGTTTGG - Intronic
1035067208 7:156115454-156115476 ATGAACACTGGAAAGTAGTATGG + Intergenic
1036608737 8:10331390-10331412 AAGAACAGTGGAATGTTGTACGG + Intronic
1037842095 8:22252006-22252028 AGGAACTTTGAAAAGAAGGAAGG - Exonic
1039249493 8:35646371-35646393 AAGAACATTGGAAGGCAGTCAGG + Intronic
1041273197 8:56129899-56129921 AAGGACATTGCAAAGAAGAAGGG + Intergenic
1042010340 8:64237546-64237568 AAGAAGAATGAATAGTATTACGG + Intergenic
1042520824 8:69709541-69709563 AAAAACACAGAAAAGTAGGAAGG + Intronic
1043240472 8:77927432-77927454 AAGACAATTGAAAAATATTAAGG - Intergenic
1043973937 8:86564181-86564203 AAGAAAAATAAAAAGTACTAGGG - Intronic
1044079018 8:87860838-87860860 AAGAACTCTGAAATCTAGTAAGG - Intergenic
1044597593 8:93973363-93973385 AACAAAATTAAAAAGTAATATGG - Intergenic
1045359643 8:101421064-101421086 AAGATCATTGTAGAGTAGTTGGG + Intergenic
1045836760 8:106531397-106531419 GAGAACATTGAAATGCAGCAGGG - Intronic
1045997723 8:108382908-108382930 AAGAAAATTAAAAATTAGTCTGG + Intronic
1046033646 8:108814484-108814506 TAGACCATTAAAAAGTAGCAAGG - Intergenic
1046494806 8:114999484-114999506 TAGAACATTTTATAGTAGTAAGG - Intergenic
1046630084 8:116615165-116615187 AAGAACACTGAATTGGAGTAAGG + Intergenic
1046802581 8:118445059-118445081 AAGGACATTGCAAGATAGTAAGG - Intronic
1046870057 8:119196286-119196308 AACTAAATTGGAAAGTAGTATGG - Intronic
1048742665 8:137579445-137579467 AAGAACACTCAAAAATAGAATGG + Intergenic
1050858411 9:10392021-10392043 AAGAAAAATAAAACGTAGTAGGG - Intronic
1051155012 9:14133120-14133142 AAGAACTTTGAAAATTATGAGGG - Intronic
1051786951 9:20755579-20755601 AAGAATATTGAAAAGCACTTCGG + Intronic
1052385273 9:27815700-27815722 AATCCCATTAAAAAGTAGTAAGG + Intergenic
1053334001 9:37247408-37247430 AAGAACACTTAAATGCAGTAAGG - Intronic
1053499648 9:38574792-38574814 AAGAAACTTTAAAAGTGGTATGG + Intronic
1053899054 9:42774711-42774733 ATGAACAATGAAAAGTCATATGG - Intergenic
1054738622 9:68781426-68781448 AATAACATTAAAAATTAGTGTGG - Exonic
1055045871 9:71923214-71923236 AAGTACAGTAAAAAGTAGAAGGG - Intronic
1055841215 9:80506497-80506519 AAGAATATTAAAAAGAAGAAGGG - Intergenic
1056156300 9:83841418-83841440 AAGACCAGTGAAAAATAATATGG - Intronic
1056354231 9:85782163-85782185 AAGACCAGTGAAAAATAATATGG + Intergenic
1056678557 9:88697240-88697262 AACAACATTCAAAAGAAGGAGGG - Intergenic
1058012966 9:99998684-99998706 AAGAAAATTGCAGAGAAGTAAGG - Intronic
1058139340 9:101341468-101341490 GAGAACATTGAAATGTTGCAGGG - Intergenic
1058342717 9:103918496-103918518 TATAACATAGAAAAGTAGAAAGG + Intergenic
1058411247 9:104734987-104735009 AAGGACATTGATAAATAATATGG + Intergenic
1058759395 9:108116230-108116252 AAGAACATTGAAAAACACAAAGG + Intergenic
1059910420 9:119037497-119037519 AAGTACTTTGAAAAGCAGTGGGG + Intergenic
1061572435 9:131486021-131486043 AGGGACATTGAGAAGTAGTGAGG + Intronic
1203544637 Un_KI270743v1:120154-120176 AACAAAATTTAAAAGTATTAAGG + Intergenic
1186318529 X:8398005-8398027 AATAAAAATGAAAAGTAGGAGGG - Intergenic
1186565078 X:10653734-10653756 AAAAACATTGATAAGTTTTATGG + Intronic
1187656313 X:21478818-21478840 AAGATCATTAGAAAGCAGTATGG + Intronic
1187679126 X:21749053-21749075 AAGAACAATGACAACTAGTGGGG + Intronic
1187880227 X:23840460-23840482 ATGAACATTAAAAATTATTATGG + Intronic
1188138165 X:26515090-26515112 AAGAACACTAAATAGTAGCATGG + Intergenic
1188413802 X:29906680-29906702 AACAAAATTGAAAAATATTAGGG - Intronic
1189583473 X:42432098-42432120 AGTAACATTGAAAAGTTCTAGGG + Intergenic
1189828395 X:44944370-44944392 AACAATTTTGAAAAATAGTAAGG - Intronic
1191597004 X:62956689-62956711 ATAAACATTGAAAAGCATTAGGG - Intergenic
1191744260 X:64468336-64468358 AAAAAAATTGAAAAGTAGCTGGG + Intergenic
1192294110 X:69828751-69828773 AAACACATTGAATAGTAGTCAGG + Intronic
1193112574 X:77744154-77744176 AAGAAAATTGAAAATTAGCCAGG + Intronic
1193956032 X:87863955-87863977 AGGAACATTGAAAAGCAGACTGG - Intergenic
1194354443 X:92864361-92864383 AAGAAGACTGAACAATAGTATGG - Intergenic
1194358950 X:92923446-92923468 ACAAACATTTAAAATTAGTAAGG + Intergenic
1194453036 X:94068556-94068578 AATAACACTGAAAATTAGGAGGG - Intergenic
1195392879 X:104381414-104381436 AAGAACATTGTGAACTAGGAAGG - Intergenic
1196553302 X:117056657-117056679 AGGAACATTGCAAAGTAGTGGGG + Intergenic
1196645545 X:118113723-118113745 AAGAGCAATGAAAATAAGTAGGG - Intronic
1197330490 X:125148210-125148232 AAGGAGATTGAAAAGGAGAAAGG - Intergenic
1197424143 X:126273785-126273807 AAGAAAATTGAGAATAAGTAAGG - Intergenic
1198420376 X:136465656-136465678 AAAAACATTTAAAATTAGTTGGG - Intergenic
1199166934 X:144687410-144687432 AAGAAGATTGAAAATTAATCAGG - Intergenic
1199611069 X:149614343-149614365 AAGAAAATTGAAAAATATTTTGG + Intronic
1199658893 X:150026553-150026575 AAGAACAAAGAAAATTACTAAGG + Intergenic
1200662802 Y:5981389-5981411 AAGAAGACTGAACAATAGTATGG - Intergenic
1201747857 Y:17399000-17399022 AAGAACTTTAAAAATTAATATGG - Intergenic