ID: 983509085

View in Genome Browser
Species Human (GRCh38)
Location 4:168588193-168588215
Sequence CACTGTGAGCCCTGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 472}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983509079_983509085 -5 Left 983509079 4:168588175-168588197 CCAGTTTCCTACCAGGATCACTG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG 0: 1
1: 0
2: 4
3: 50
4: 472
983509075_983509085 2 Left 983509075 4:168588168-168588190 CCCATTCCCAGTTTCCTACCAGG 0: 1
1: 0
2: 2
3: 18
4: 196
Right 983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG 0: 1
1: 0
2: 4
3: 50
4: 472
983509077_983509085 1 Left 983509077 4:168588169-168588191 CCATTCCCAGTTTCCTACCAGGA 0: 1
1: 0
2: 1
3: 25
4: 238
Right 983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG 0: 1
1: 0
2: 4
3: 50
4: 472
983509073_983509085 9 Left 983509073 4:168588161-168588183 CCTTGACCCCATTCCCAGTTTCC 0: 1
1: 0
2: 2
3: 58
4: 463
Right 983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG 0: 1
1: 0
2: 4
3: 50
4: 472
983509078_983509085 -4 Left 983509078 4:168588174-168588196 CCCAGTTTCCTACCAGGATCACT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG 0: 1
1: 0
2: 4
3: 50
4: 472
983509072_983509085 10 Left 983509072 4:168588160-168588182 CCCTTGACCCCATTCCCAGTTTC 0: 1
1: 0
2: 8
3: 26
4: 322
Right 983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG 0: 1
1: 0
2: 4
3: 50
4: 472
983509074_983509085 3 Left 983509074 4:168588167-168588189 CCCCATTCCCAGTTTCCTACCAG 0: 1
1: 0
2: 2
3: 23
4: 293
Right 983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG 0: 1
1: 0
2: 4
3: 50
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983509085 Original CRISPR CACTGTGAGCCCTGGGAGGA TGG Intronic
900167252 1:1248683-1248705 CACAGGCAGCCCTGGGAGGCTGG + Intergenic
900167337 1:1248947-1248969 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167360 1:1249013-1249035 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167383 1:1249079-1249101 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167407 1:1249145-1249167 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167431 1:1249211-1249233 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167455 1:1249277-1249299 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167479 1:1249343-1249365 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167503 1:1249409-1249431 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167527 1:1249475-1249497 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900167551 1:1249541-1249563 CACGGGCAGCCCTGGGAGGCTGG + Intergenic
900290355 1:1921118-1921140 CACTGTGGGCCCTGGGGGGCTGG + Intergenic
900363008 1:2298979-2299001 GCCTGTGAGCCCTGGGTGGGTGG + Intronic
901016611 1:6235624-6235646 CACTGCGGGCCCGGGGAGAAAGG + Intronic
901126693 1:6934439-6934461 GAATGGGTGCCCTGGGAGGATGG + Intronic
902410979 1:16211440-16211462 CCCTGTGAGCCATGGGAGAGAGG - Intronic
902772165 1:18651773-18651795 CACTGTGAAGCCTGGAGGGAGGG - Intronic
902799185 1:18818960-18818982 CACTGTGAAGCCTGGGAGTGAGG - Intergenic
903184852 1:21623085-21623107 CACTGTGAGGCATGGGAAGCAGG - Intronic
904405237 1:30283922-30283944 CCCTGTGAGGACTGGGAGAAGGG + Intergenic
904410377 1:30321521-30321543 TAGGGTGAGCCCTGGGAGGGGGG - Intergenic
904463641 1:30695021-30695043 CCCTGAGAGACCTGGGAGGAGGG + Intergenic
904482091 1:30800522-30800544 CACCGTGGGCCCTGGGTGAAGGG - Intergenic
904622080 1:31781777-31781799 CACTGCCAGCCCTGGAAGGTGGG + Intergenic
904729648 1:32579720-32579742 GACTGTGATCCCTGAGAGAATGG - Intronic
904981871 1:34510674-34510696 GACTGTGATCCCTGAGAGTAGGG + Intergenic
905104924 1:35558504-35558526 GACTGAGAGCCCTGGCTGGAGGG + Intronic
905694674 1:39965795-39965817 GATTGTGGGCCCAGGGAGGAAGG - Intronic
905807858 1:40889920-40889942 TACTATGAGCCCTGGAGGGAGGG + Intergenic
906035515 1:42748140-42748162 CACTGTGGGGCCTCTGAGGAGGG + Intronic
906697164 1:47830745-47830767 CACTGTGAGCCAGGGAAAGACGG + Intronic
907510447 1:54954199-54954221 CACTCTGAGCCCTTGGAGGGTGG - Intergenic
907715329 1:56921366-56921388 CACTGAGTGCCATGAGAGGAAGG + Intergenic
907924557 1:58943725-58943747 GACTGTGAGCCCTTGAAGGAAGG - Intergenic
908143021 1:61207475-61207497 CACTGGGGGAGCTGGGAGGAAGG - Intronic
908153279 1:61326594-61326616 GACTGTAAGCCCTCTGAGGAGGG - Intronic
908883385 1:68758967-68758989 CACTGTGGGGCATGGGAGGGTGG - Intergenic
909907923 1:81221651-81221673 CACTGTGAGCACTGGGAACCTGG - Intergenic
913010581 1:114679228-114679250 GACTGTAAGACCTTGGAGGAAGG - Intronic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913074831 1:115333124-115333146 CTAAGTGAGCCCAGGGAGGATGG - Intronic
914951711 1:152121155-152121177 CACTGTTAGCTCTGGGCAGAGGG + Intergenic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
915327215 1:155086639-155086661 CACTTCTAGCCATGGGAGGAGGG - Exonic
916584416 1:166138029-166138051 CACTGTGAGAGCAGGAAGGAGGG - Intronic
916631406 1:166618188-166618210 CACAGTGAGCCTTGGGAGATGGG + Intergenic
917618922 1:176774971-176774993 CACGGAGAGCTCTGGGAAGAAGG - Intronic
918079038 1:181191750-181191772 CTCTGTGAGCCTGGGGAGGGTGG + Intergenic
919849227 1:201661318-201661340 CAGTGAGAGGCTTGGGAGGAAGG - Intronic
920377330 1:205516198-205516220 CACAGTTCTCCCTGGGAGGAGGG + Intronic
920404306 1:205697486-205697508 CAAAGGTAGCCCTGGGAGGAGGG + Intergenic
920448613 1:206039550-206039572 CACTGCAAGCCCTGGGTGGGAGG + Intronic
920815856 1:209331337-209331359 CAATGTGAGGCCTTGGAGGACGG - Intergenic
921675147 1:217968387-217968409 CAGAGTGAGTCCTGGGAGGTGGG - Intergenic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
922968245 1:229710700-229710722 GACTGTGACCCCTGAGAGAAGGG + Intergenic
923286663 1:232502734-232502756 CATTGTGAGCCCTTAGAAGATGG - Intronic
1062894318 10:1091184-1091206 CACTGTGAGGTGTGGGTGGAAGG - Intronic
1062939033 10:1408013-1408035 CAGTGTGAGCCCTTGGAAGGTGG - Intronic
1063462097 10:6221524-6221546 CGCGGTGAGTCCTGGGAGGCGGG + Exonic
1064016421 10:11776065-11776087 CACTCAGAGCCCTGAGAGGTAGG + Intergenic
1064420369 10:15185488-15185510 CCCTGTGAGGCCTGGCAGTAAGG + Intergenic
1064973554 10:21090096-21090118 CACTGTGAGCTCCAGGAGAATGG + Intronic
1065181834 10:23134019-23134041 CACTGTGAGCCCTTGCAAGTTGG - Intergenic
1065833560 10:29637094-29637116 CACTGTGAGGCCAGGCAGGGTGG - Intronic
1065969053 10:30791464-30791486 CACTGTGGGCCATTGGAGGGTGG + Intergenic
1066199349 10:33130159-33130181 GACTGGGAGCCCCGGGAGGGAGG + Intergenic
1066221945 10:33343806-33343828 CACTGTTAGCCAGGTGAGGAAGG + Intergenic
1067099622 10:43325144-43325166 CAGTGTGAGCCATGGGTGGTGGG + Intergenic
1067163279 10:43845040-43845062 AAATGTAAGCCTTGGGAGGAAGG - Intergenic
1067215137 10:44294944-44294966 CTCTGTGGGGCCTGGGAGCAAGG + Intergenic
1067831322 10:49612634-49612656 CACTGGGAGCAATGGAAGGAAGG - Exonic
1069322390 10:67188035-67188057 AGATGTGAGCCCTGTGAGGAGGG - Intronic
1069622715 10:69847711-69847733 GATTAGGAGCCCTGGGAGGAAGG + Intronic
1070624984 10:78044674-78044696 GACTGTGGGCACTGGGAGGCAGG - Intronic
1070788285 10:79174966-79174988 CAGAGAGAGGCCTGGGAGGAAGG - Intronic
1070819524 10:79346813-79346835 CAGTGTGGGTCCTAGGAGGAGGG + Intergenic
1070829835 10:79411558-79411580 CACACTGAGCCCTGGGAGGCTGG - Intronic
1070870723 10:79749504-79749526 CACTGTCATCCCTGAAAGGAAGG + Intergenic
1071563821 10:86661565-86661587 CACCGTGACCCCTGGGAAGCTGG - Intronic
1072417387 10:95260541-95260563 CACTGTGTGCACTGGGAGGAAGG + Intronic
1072842663 10:98792678-98792700 CACTCTGACCCCTGGGTGGCAGG - Intronic
1073119769 10:101114417-101114439 AAATGTCAGCCCTGGGGGGAGGG - Intronic
1075105893 10:119539728-119539750 CACTCTGAACCTTGGAAGGAGGG + Intronic
1075130371 10:119732883-119732905 CACAGTAAACCTTGGGAGGATGG + Intronic
1075408744 10:122211875-122211897 CACTGTGACCGCAGAGAGGAAGG - Intronic
1075677022 10:124303027-124303049 CCCAGTGAACCCTGGGAGGTGGG - Intergenic
1076325359 10:129616514-129616536 CAATGGGGGGCCTGGGAGGATGG - Intronic
1076704901 10:132295978-132296000 CACTGTCCTCCCTGGCAGGATGG - Intronic
1076935576 10:133566174-133566196 CCCGGAGGGCCCTGGGAGGAGGG + Intronic
1077411543 11:2406157-2406179 CACAGGGAGGCCTGGGGGGATGG - Intronic
1077490144 11:2857326-2857348 CACTGGGTGCCCTTGGACGAGGG - Intergenic
1077538012 11:3133759-3133781 CGCTGTGGGGCTTGGGAGGAAGG + Intronic
1077581221 11:3418548-3418570 CACTGGCACCCCTGGGAGGGAGG - Intergenic
1078059571 11:8034354-8034376 CACTGTAAGCTCTAGGAAGAGGG + Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081668025 11:44927852-44927874 CCCTCTGTGCCCTGGGAGCAGGG - Intronic
1083375166 11:62214552-62214574 CACTGTGGGGCAGGGGAGGATGG - Intergenic
1083612649 11:64011470-64011492 CTCTGTGTGCCCTGGGAGCCAGG - Intronic
1083784249 11:64934735-64934757 CCCTGTGACCCAGGGGAGGAAGG + Exonic
1083899287 11:65635957-65635979 CACTGTCAGCTCTGGGGGTAAGG - Intronic
1084155004 11:67308400-67308422 CACTCTGAGCCCTGGGAGAGAGG - Exonic
1084483740 11:69436396-69436418 CACGGTAAGCCCTGTGAGGGCGG - Intergenic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1086120944 11:83304054-83304076 CACTCTGAGGCCTGGGGAGATGG + Intergenic
1086340331 11:85842449-85842471 CACTGAGAACCCTGGGAGACAGG - Intergenic
1088831221 11:113538636-113538658 CAATGTGAGCCCCAGGAGGCAGG + Intergenic
1088908965 11:114176219-114176241 CAAGGGGAGACCTGGGAGGAGGG + Intronic
1089396253 11:118137863-118137885 CACGGAGAGCTCAGGGAGGAAGG - Intronic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1090893893 11:130952116-130952138 CACTGTGTGCCATGTGAGGATGG - Intergenic
1091431970 12:443745-443767 CTCTCTGAGGCCTGGGAGCAGGG - Intergenic
1094212505 12:27907201-27907223 CACTGTGAGGCCTAGGCTGAAGG - Intergenic
1094526121 12:31232399-31232421 CACTGCCAGCCCTCGGAGGAGGG - Intergenic
1095609141 12:44107272-44107294 CACTGTGAGCCCTGGAGCCAAGG - Intronic
1097168643 12:57099588-57099610 CACTGTGAGCTCTGTGGGAACGG - Intronic
1097915072 12:65012683-65012705 CCATTTGAGCCCTGGGAAGAAGG + Intergenic
1098698093 12:73584862-73584884 CACTGTGTGAGCTTGGAGGAGGG - Intergenic
1098896738 12:76071285-76071307 GCCTGTTAGCCCTGGGAGGGTGG - Intronic
1100659118 12:96677895-96677917 CATTATGAGCCCAGGGAGCAGGG - Intronic
1102027733 12:109723147-109723169 CATTTTGAGCCCGGGGTGGATGG + Intronic
1102255004 12:111410100-111410122 CCCAGGGAGGCCTGGGAGGAAGG + Intronic
1102974596 12:117197443-117197465 CACTGGGAAGCCAGGGAGGAGGG - Intergenic
1103700879 12:122848197-122848219 CTCACTGAGCCCGGGGAGGAGGG + Intronic
1103832639 12:123792390-123792412 GACAATGAGCTCTGGGAGGAAGG - Intronic
1103904641 12:124321099-124321121 CACTCTGTGCCCTGGGTGGAGGG + Intergenic
1104551515 12:129761473-129761495 CCCTCAGAGGCCTGGGAGGATGG - Intronic
1104587755 12:130061268-130061290 CACTGTGAGCCCTGAGTGGATGG + Intergenic
1104962499 12:132494979-132495001 CACAGACAGCCCTGGGAGGCCGG - Intronic
1105058106 12:133122246-133122268 CACTTTGAGCTCTGGGTGAATGG + Intronic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1106387553 13:29302479-29302501 CCCTGGGATCCCTGGGAAGATGG + Intronic
1106593074 13:31114535-31114557 CACTGTGTGCCTGTGGAGGAGGG + Intergenic
1106761171 13:32869334-32869356 GACTGTGATCCCTGAGAGTAGGG + Intergenic
1107456888 13:40563471-40563493 CACTGTATGCTCTGGCAGGAGGG - Intronic
1109386074 13:61630384-61630406 CACTTTGAGGCCTAGGTGGATGG + Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1113407476 13:110054992-110055014 CACTATGAGACCAGGTAGGATGG - Intergenic
1113680748 13:112243010-112243032 AACTGTCAGCATTGGGAGGAAGG - Intergenic
1113752421 13:112785459-112785481 CGCTGTGAGCCCTGGGCAGGTGG - Intronic
1114451605 14:22830107-22830129 TACAGTGAGTCCTGGGATGAGGG + Exonic
1114605195 14:23990308-23990330 CACTGTGTGCCATGTGGGGAAGG + Exonic
1114673452 14:24426888-24426910 CAGTGAGAGAGCTGGGAGGAAGG + Exonic
1115301164 14:31887101-31887123 CACTGTCATCACTGGAAGGAGGG - Intergenic
1116257192 14:42571257-42571279 CAAACAGAGCCCTGGGAGGAAGG + Intergenic
1117240688 14:53829473-53829495 CACTGTGAGAGATGGGAGGATGG - Intergenic
1117813921 14:59577676-59577698 AACTGTGAGCTCTGTGATGACGG + Intergenic
1118128674 14:62937842-62937864 CAGTGTGTGCCTGGGGAGGAGGG + Intronic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1118783617 14:69027334-69027356 GCCTGTGATCCCTGGGAGCAGGG + Intergenic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1121696685 14:95918988-95919010 GACTGCAAGCCCTTGGAGGAAGG - Intergenic
1122138581 14:99648702-99648724 CAGTCAGAGCCCTGGGAGCATGG + Intronic
1122155261 14:99746836-99746858 AACTGGGAGCCCTGGGTGGGAGG - Intronic
1122215613 14:100201951-100201973 CAATGTGAGCCCAGGGAAGTGGG + Intergenic
1122355570 14:101121152-101121174 TCCCCTGAGCCCTGGGAGGACGG - Intergenic
1122374080 14:101247150-101247172 CAGTGAGAGAGCTGGGAGGATGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123020174 14:105394320-105394342 CACTCAGAGCCCTGGGGGGTGGG - Intronic
1123709281 15:22974989-22975011 CACTGTGAGCTTTTTGAGGATGG + Intronic
1124379387 15:29151903-29151925 CATTCTGGGCCCTGGCAGGAGGG - Intronic
1124699988 15:31904369-31904391 CTCTGGGAGCCCTGCGTGGAGGG + Intergenic
1125676042 15:41503071-41503093 CACCGGCGGCCCTGGGAGGAGGG + Exonic
1127046287 15:55029017-55029039 CACAATGAGCACTGGCAGGATGG + Intergenic
1128065179 15:64760098-64760120 CTGTGTGTGCCCTGGAAGGAGGG - Intronic
1128157768 15:65402478-65402500 CACGATGAGCCTTGGGAAGAGGG + Exonic
1128328239 15:66739034-66739056 CTCTTAGAGCCCTGGGAAGATGG - Intronic
1128713102 15:69886664-69886686 TGCTGGGAGCTCTGGGAGGATGG - Intergenic
1128940595 15:71784839-71784861 CACACTGAGCCCGGGTAGGATGG - Intergenic
1129326501 15:74802702-74802724 CACTGAGGGGCCAGGGAGGAAGG + Exonic
1130057321 15:80537763-80537785 CACTGACATCCCTGGCAGGAGGG + Intronic
1130326228 15:82882402-82882424 GACTGTGAGCTCTTTGAGGATGG - Intronic
1132166171 15:99593326-99593348 CACTGTGAGGCCTGGAAAAAGGG - Intronic
1132317565 15:100900955-100900977 CACACTGAGGCATGGGAGGAGGG + Intronic
1132519223 16:379754-379776 GGCTGTGAGCCCTGGGAGTCGGG - Intronic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1133684726 16:8155264-8155286 CACTGTCAGAGGTGGGAGGAAGG - Intergenic
1135908848 16:26540995-26541017 AACTGTGACCTCGGGGAGGAAGG + Intergenic
1136280472 16:29206042-29206064 GACTGTGATCCCTGTGAGAAAGG + Intergenic
1136366778 16:29812585-29812607 GCCTGGGAGCCCAGGGAGGAGGG + Intronic
1137508322 16:49076111-49076133 AACTGTGATCTCTGAGAGGAGGG - Intergenic
1138338801 16:56274202-56274224 GACTGTGATCCCTGAGAGAAGGG - Intronic
1138550199 16:57743684-57743706 CACTGCGAGGCCTGGGAGGCTGG - Intronic
1139268679 16:65662559-65662581 CACTGTGACGCCTGAGAGGAAGG + Intergenic
1139446954 16:67003936-67003958 CATGGTGAGCCCCAGGAGGATGG - Intronic
1139447951 16:67009784-67009806 CAATTTGAGCCCTGAGAGAAAGG + Intergenic
1140806141 16:78533866-78533888 CTCTGTGAGCCCTTTGAGGATGG + Intronic
1141517857 16:84558404-84558426 AGAGGTGAGCCCTGGGAGGAGGG - Intergenic
1141723196 16:85768250-85768272 CACTGGAGGCCTTGGGAGGAAGG - Intergenic
1142084839 16:88172001-88172023 GACTGTGATCCCTGCGAGAAAGG + Intergenic
1142337932 16:89502299-89502321 GAATGTGAGGCCAGGGAGGAGGG - Intronic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1142429630 16:90019228-90019250 AAGGGTGAGCCCTGGGGGGAGGG + Intronic
1142998880 17:3778009-3778031 GACTGTGAGCCCCAGGAAGAGGG + Intronic
1143582556 17:7835386-7835408 CAGGAAGAGCCCTGGGAGGAAGG + Intergenic
1144575693 17:16428037-16428059 CCCTGTGAGGCCAGGGAGAAGGG + Intronic
1144731546 17:17529021-17529043 CACTATGAGCCCTGGTGAGAAGG - Intronic
1145063071 17:19744567-19744589 CCCTGTGAGAACTGGGAGGGAGG + Intronic
1145273633 17:21417635-21417657 CACTGTGGGCCCAGTGGGGACGG - Exonic
1145311828 17:21705077-21705099 CACTGTGGGCCCAGTGGGGACGG - Intergenic
1145411644 17:22670919-22670941 CCCTGTGAGGCCCGGGATGAAGG + Intergenic
1146445526 17:32929702-32929724 CTCTGTGAGCCCTTTGAGAAAGG + Intronic
1147036315 17:37684097-37684119 CACAGAGAGCACTGGGAAGATGG - Intergenic
1148085351 17:44990542-44990564 CACTTTGAGTTCTGGGAGGGAGG - Intergenic
1148496052 17:48054245-48054267 CAGTGAGAGCCCTGGGGGAAGGG - Intronic
1148810181 17:50285340-50285362 CCCTGTGAAGACTGGGAGGAGGG - Intergenic
1149274497 17:55018009-55018031 TCCTGGGAGCCCTGGGAGCAAGG - Intronic
1149300792 17:55303257-55303279 CCATGGCAGCCCTGGGAGGAGGG + Intronic
1150660119 17:67067947-67067969 CACACGGAGCCGTGGGAGGATGG - Intergenic
1150769731 17:68030809-68030831 CACTGGGAGCCCTATGAGGAAGG - Intergenic
1151198959 17:72453652-72453674 GACTGTGAGACCTGGCAGGAGGG - Intergenic
1151301694 17:73231944-73231966 CACTGCGGGCCGGGGGAGGAGGG - Intronic
1154253186 18:12761275-12761297 CCCGGTGCGCCCTGTGAGGATGG + Intergenic
1155243068 18:23881963-23881985 CACTGTGAACGCTGCCAGGAGGG + Exonic
1156030255 18:32704842-32704864 CACAGTGGGCTCTGGGATGAAGG - Intronic
1156391929 18:36659183-36659205 GACCTTAAGCCCTGGGAGGAAGG + Intronic
1156394837 18:36690135-36690157 AACTGTGAGCTCTGTGAGGGTGG + Intronic
1156690352 18:39700137-39700159 CAATGTGAGCCTTGGGAAGCAGG - Intergenic
1157654272 18:49369926-49369948 CTCTGTGAGCACTGAGGGGAGGG - Intronic
1159006690 18:63019668-63019690 CACCTTCAGCCCTGGGAGGGAGG - Intergenic
1160134616 18:76261873-76261895 CAGTGGGAGCGCTGGGAGGGAGG + Intergenic
1161073395 19:2273544-2273566 CACAGAGGGCCCTGGGTGGAGGG + Intronic
1161556219 19:4944292-4944314 CAGCGTGAGCCCTGGCAGGCGGG - Intronic
1161651884 19:5490717-5490739 GACTGTGAGCCATGTGTGGATGG + Intergenic
1162029160 19:7909947-7909969 CCGTGCCAGCCCTGGGAGGAGGG + Intronic
1162584628 19:11551489-11551511 CCCTGTTATCCCCGGGAGGAGGG + Intronic
1162900699 19:13794156-13794178 CACTGTGAGCCTCAGGAGGCAGG - Intergenic
1162942702 19:14022920-14022942 CACTGGGAGGCCAAGGAGGACGG - Intergenic
1163111152 19:15161463-15161485 CGCTTTGAGGCCAGGGAGGAAGG + Exonic
1164804091 19:31102793-31102815 CCATGTGAGCTCTGGGAGGGTGG - Intergenic
1165778962 19:38421061-38421083 GACTGTGAGCTATGGGTGGAGGG - Intronic
1165874047 19:38993160-38993182 TATTATGAGGCCTGGGAGGATGG - Intronic
1165935532 19:39386439-39386461 CTCTGGGAGCCCTGGGAGGGTGG - Intronic
1165974041 19:39658602-39658624 CACTATGTGCCCTTTGAGGATGG + Exonic
1166297473 19:41896141-41896163 CCCTGTGTGTCCTGGGTGGATGG - Intronic
1166811314 19:45516203-45516225 GACTGTGAGCCCCAGGAGGGTGG + Intronic
1167006998 19:46782664-46782686 GACTGGGAGCCTTGGGAGGAAGG - Intronic
1167124370 19:47539147-47539169 GACTAGGAGCCCTGGGAGGCAGG + Intronic
1168329834 19:55561290-55561312 AAGTGTGAGCACTGGGAGGCAGG + Intergenic
1168557898 19:57358744-57358766 TCCTGTGAGCCCAGTGAGGAGGG + Exonic
1168720377 19:58551503-58551525 GACTGGGGTCCCTGGGAGGATGG - Intergenic
925504274 2:4543508-4543530 GACTGTGAGGCCTGGTGGGAGGG - Intergenic
925891657 2:8439524-8439546 GAGGGTGAGCCCCGGGAGGAAGG + Intergenic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
926307790 2:11651660-11651682 CACTGTGAACCCTTGTAGTAAGG - Intergenic
926927482 2:18002088-18002110 CCATGTGCGCCCTGGGGGGAGGG + Intronic
927857376 2:26535989-26536011 CCCTGGGAGTCTTGGGAGGAGGG + Intronic
928167527 2:28981782-28981804 CACTGGGAGCCAAGGAAGGAGGG + Intronic
928856428 2:35808203-35808225 TTCCGTGAGCCCTGGGAGGCAGG - Intergenic
928986802 2:37190006-37190028 CAGTGTGAGTCATGGGAGGGTGG - Intronic
930353768 2:50291557-50291579 CCTTGTGATCCATGGGAGGATGG - Intronic
931091694 2:58893365-58893387 GACTGTGAGCCCTGGGATGGAGG - Intergenic
931147542 2:59535333-59535355 CCCGTTGAGCCCTGGAAGGAGGG + Intergenic
931251431 2:60534197-60534219 CACTGGGAGCCCAGGGAGCCTGG + Intronic
931775621 2:65538052-65538074 CACTGTCAGCCCGGGTAGGGGGG - Intergenic
932045204 2:68341688-68341710 GACTGTGAAACCTGGGAGGAGGG + Intergenic
932399451 2:71469641-71469663 GACTATGAGCTCTGGGAGGCTGG + Intronic
932433504 2:71689401-71689423 AACTGTGAGCTCTAGGAGGGTGG - Intergenic
932805381 2:74778564-74778586 CTCTGTGGGCCTTGGAAGGAGGG - Intergenic
934735019 2:96685711-96685733 CCCTGCAGGCCCTGGGAGGAAGG + Intergenic
935530697 2:104229579-104229601 CACTGTGGCCACTTGGAGGAAGG - Intergenic
935577877 2:104729563-104729585 CACAGTGAGCTCTGAGAGAAAGG - Intergenic
935634140 2:105237100-105237122 CAGTTTCAGCGCTGGGAGGAAGG + Intergenic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935943920 2:108269273-108269295 CAATGTGCCCCCTGGGTGGAAGG - Intergenic
936027574 2:109045413-109045435 GACTGTTAGCCCAGCGAGGAAGG + Intergenic
936437790 2:112522942-112522964 CACTGGCTGCTCTGGGAGGATGG - Intronic
937111744 2:119371946-119371968 CATTGTGAGCCTTGGGAGAGAGG - Intronic
937253833 2:120541040-120541062 AACTGAGAGCCCTGTGAGAAGGG - Intergenic
937265678 2:120613415-120613437 CACTTTGACCCTGGGGAGGATGG - Intergenic
937321023 2:120960840-120960862 CACTGGGAGACCAGGGAGGGTGG - Intronic
938318771 2:130348071-130348093 CACTGGGTACCCAGGGAGGAGGG + Intergenic
938343349 2:130549623-130549645 CTCTCCGGGCCCTGGGAGGAAGG - Intronic
938346484 2:130571099-130571121 CTCTCCGGGCCCTGGGAGGAAGG + Intronic
939151265 2:138475750-138475772 CACTGTAAGCCCAGGAAGCAGGG + Intergenic
942657098 2:178225538-178225560 CAGTCAGAGCCCTGGGAGGTAGG + Intronic
943180233 2:184530993-184531015 CAGTGTGAGGCCTGGGAGCTGGG - Intergenic
943380084 2:187133905-187133927 CACTCTGTGCCCTGGGAGGCTGG - Intergenic
944787113 2:203083279-203083301 GATTGTGATTCCTGGGAGGATGG + Exonic
945515217 2:210755364-210755386 CCCTGTGAGGCCTTGGAGGGAGG - Intergenic
945984128 2:216340610-216340632 CTCTGTCAACCCTGGGAGGCTGG - Intronic
945985793 2:216352470-216352492 AAATGTCACCCCTGGGAGGAAGG - Intronic
946999652 2:225439392-225439414 CACTGAGAGTCCTGAAAGGATGG + Intronic
947395795 2:229685884-229685906 CAGTGTGAGGCATCGGAGGAGGG + Intronic
947711187 2:232317052-232317074 CGCTGTGTGCCCTGGGAGGCAGG + Intronic
948872030 2:240806076-240806098 GACTGTGATCCCTGAGAGAAGGG + Intronic
1168759598 20:340938-340960 CTCTGAGAGCCTGGGGAGGAGGG - Intergenic
1168841790 20:914450-914472 CATGGTTAGCCCTGGGAGGAGGG + Intronic
1168970394 20:1926864-1926886 CACTGTGAGCATTGAGAGGCTGG - Intronic
1169102456 20:2962959-2962981 GACTGTGAGTCCTGTGAAGATGG + Intronic
1169888610 20:10429725-10429747 GACTGTGACCCTAGGGAGGAGGG - Intronic
1170208473 20:13824331-13824353 CACTATGACCCCTGTGAGCACGG + Intergenic
1170252114 20:14295359-14295381 GACTGTGAGACCTGAGAGGAGGG + Intronic
1171188286 20:23139098-23139120 AACTGTGAGGCCTGTGAGGGAGG + Intergenic
1171542911 20:25978216-25978238 CCCTGTGAGGCCTGGGATGAAGG + Intergenic
1172222664 20:33284487-33284509 AGCTGTGAGCTCTGGGAGGGAGG - Intronic
1172226261 20:33307034-33307056 CACTGAGAGCCCTGGCTGGGAGG + Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1173910901 20:46670065-46670087 CACTGGGAGGCTTGGGAGGCTGG + Intronic
1175274825 20:57761148-57761170 CACTGTGAGGCCAGGGTGGCAGG - Intergenic
1175893154 20:62324155-62324177 CACTGTGAGCGCTGCCAGGCTGG - Exonic
1175914235 20:62418379-62418401 CAGTGTGGTCCCTGTGAGGAGGG + Intronic
1177309591 21:19372371-19372393 CTTTGGGAGCCCTAGGAGGATGG - Intergenic
1177873842 21:26607549-26607571 CACTGTGAGCCATCACAGGAGGG - Intergenic
1178569293 21:33720147-33720169 AACTGTAAGGCCTGTGAGGAAGG + Intronic
1178669529 21:34578604-34578626 CACTCTGGGCCCTGGGGGAATGG + Intronic
1178823658 21:35997506-35997528 CACTGTGAGACCTGAGTAGATGG + Intronic
1178948210 21:36966001-36966023 CTCTGGGAGGCCTAGGAGGAAGG - Intronic
1179022847 21:37655936-37655958 CACACACAGCCCTGGGAGGATGG + Intronic
1179178999 21:39029440-39029462 CACTGAGAGCCCAGGGCTGATGG - Intergenic
1179204375 21:39260666-39260688 AACTGTGATCCCTGAGAGAAGGG + Intronic
1179587544 21:42383300-42383322 TGCTGTGAGCTCTGGGAGCAGGG - Intronic
1179617950 21:42593810-42593832 CAGAAGGAGCCCTGGGAGGAGGG - Intergenic
1180898300 22:19353289-19353311 CTAAGTGAGGCCTGGGAGGATGG + Intronic
1181104473 22:20565638-20565660 CACTGTCAGCTCTGGGAGAGGGG - Intronic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181556725 22:23675557-23675579 CTTTGAGAGCCCTGGGAGGCTGG + Intergenic
1181697663 22:24602028-24602050 CTTTGAGAGCCCTGGGAGGCTGG - Intronic
1183030807 22:35103060-35103082 GACTGTGAGGGGTGGGAGGAGGG - Intergenic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183269118 22:36849777-36849799 CACCGTGAGGCCTGGAGGGATGG + Intergenic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1183417165 22:37689084-37689106 CACTGCCAGCCCTGGGAAGAAGG + Intronic
1183458836 22:37937322-37937344 CACTGGGATCGCTGGTAGGAGGG - Intronic
1183569411 22:38641080-38641102 CACTGTATGGCCTGGAAGGATGG + Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1184644569 22:45889081-45889103 CACTGTGACCCCTGGCAGAGGGG + Intergenic
1184694405 22:46131553-46131575 CAGTGTGGGCCATGGAAGGAGGG + Intergenic
1185029269 22:48433124-48433146 CCCTCTGTGCCCTGGCAGGAGGG - Intergenic
1185068251 22:48642587-48642609 CACTGTGAGGCCTTTGGGGAGGG - Intronic
1185213477 22:49585356-49585378 AATTGTGAGCCCCGGAAGGAAGG + Intronic
1185299494 22:50072159-50072181 CCCAGTGAGCCATGGGAGGGCGG + Intronic
1185324076 22:50217145-50217167 CCCTGTGGTCCCTGGGAGGGGGG + Intronic
950182009 3:10920015-10920037 CACAGGCAGCCCTGCGAGGAGGG + Intronic
950507958 3:13407412-13407434 CATTGGGAGGCCTGTGAGGAGGG - Intronic
950538483 3:13595404-13595426 TTCTGTGATCCCGGGGAGGAAGG + Intronic
950545779 3:13637187-13637209 CACTGGGTGCACTGGGAAGAAGG + Intronic
951100235 3:18679092-18679114 AAATGTGAGCCCTGGCTGGAGGG + Intergenic
951628098 3:24688904-24688926 GAATGTGAGCCCTTTGAGGAGGG + Intergenic
952866818 3:37860757-37860779 CACTGTCAGGCCTAGGACGACGG - Intergenic
953568288 3:44051593-44051615 CACTGTGTGGCCTGGCGGGAGGG + Intergenic
953581921 3:44165295-44165317 CTCTGTGTGCCCTGCCAGGAAGG - Intergenic
953901719 3:46847295-46847317 CCCTGTGAGCCCAGGCGGGAAGG - Intergenic
954248044 3:49347202-49347224 CACTGTGAACCCTGGAGGGTAGG - Intergenic
954363504 3:50134570-50134592 TACTGGGACCCCTGGTAGGAAGG + Intergenic
954922819 3:54206435-54206457 GACTCTGTGTCCTGGGAGGAAGG + Intronic
955010730 3:55012049-55012071 GACTGTGAGCTCTGAGAGGCCGG + Intronic
955411028 3:58655482-58655504 CACTGTGAGCCCAGGATGGGTGG + Intronic
955623184 3:60888117-60888139 AACTGTGAACCCTGGAGGGAAGG + Intronic
955694205 3:61619420-61619442 GACTGTCAGGACTGGGAGGATGG + Intronic
959883561 3:111473786-111473808 GACTGAGATCCCTGGGGGGAGGG - Intronic
960141857 3:114158936-114158958 CACTGAGAGCCCTGGGGGAAAGG - Intronic
960546939 3:118926293-118926315 TACTGTGAGCCATGTGATGATGG + Intronic
961115236 3:124323592-124323614 CCCTGTGTGCCATGGGAGGGAGG + Intronic
961530727 3:127538470-127538492 GACTGTGAGCCCCTTGAGGATGG - Intergenic
961752933 3:129107919-129107941 GCCTGGGAGCCCGGGGAGGAGGG - Intronic
962975108 3:140439285-140439307 CAGTGAGAGGCCAGGGAGGAGGG + Intronic
966929116 3:184664235-184664257 CATACTGAGCCCTGGGAGGTGGG + Intronic
967612053 3:191518831-191518853 CACTGTGAGCCAAGAAAGGAAGG + Intergenic
967714637 3:192748518-192748540 CACAGTGAGCTTTTGGAGGAAGG + Intronic
967891938 3:194369802-194369824 CAGTGTTGGCCCTGGGAGGGGGG + Intergenic
968004806 3:195235208-195235230 CACAGTTAGAGCTGGGAGGATGG - Intronic
968267761 3:197375929-197375951 CTCTGTGAACCCTGTCAGGATGG - Intergenic
968707319 4:2086001-2086023 CACTGGCCGCACTGGGAGGAGGG - Intronic
968733774 4:2284734-2284756 CTCTGTGAGTCCTGGGATCAGGG + Intronic
969296572 4:6273642-6273664 CACTGTGAGCCCTGAGGGCAGGG - Intronic
969902825 4:10365447-10365469 CACTTTGGGCCCAAGGAGGAGGG + Intergenic
969968940 4:11026375-11026397 TCCTGTGAGTCCTGTGAGGATGG - Intergenic
970159563 4:13175391-13175413 GCCTGTGAGCCCTGGCAGGGTGG - Intergenic
970318947 4:14856619-14856641 CGCTGTTTGTCCTGGGAGGAGGG + Intergenic
973982965 4:56321994-56322016 GACTGAGAGCCCTGGAAGTAAGG + Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
981568944 4:146131521-146131543 CAGTGAGAGCACTGGGAGGTAGG - Intergenic
982216437 4:153086455-153086477 TGCTCTGTGCCCTGGGAGGAAGG - Intergenic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
983591553 4:169417792-169417814 GACTGTGATCCCTGTGAGAAGGG + Intronic
984455103 4:179956437-179956459 AACTCTGAGCCTAGGGAGGAAGG + Intergenic
985480539 5:107658-107680 AACTGTGAGTCCCTGGAGGACGG + Intergenic
985581227 5:696175-696197 CACTGGAAGCCCTGGGTGGAAGG + Intergenic
985595852 5:787507-787529 CACTGGAAGCCCTGGGTGGAAGG + Intergenic
986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG + Intergenic
986387270 5:7247110-7247132 CACTGAGAGACCTGGGAAGGAGG - Intergenic
987543580 5:19285214-19285236 CACTGGGAGGCCTAGGAGGGTGG + Intergenic
991202289 5:64008475-64008497 CAGTTTGTGCACTGGGAGGATGG + Intergenic
993580952 5:89660692-89660714 GACTCTGAGGCCTCGGAGGACGG + Intergenic
994646787 5:102479895-102479917 TACTGTGATCCCTAGGAGAAGGG - Intronic
995177787 5:109198582-109198604 AAGTGTCAGCCCTGGGAGAAAGG - Intergenic
995470440 5:112496324-112496346 TACTGTGATCCCTGAGAGCAGGG + Intergenic
997382606 5:133448498-133448520 TACTGTGAGCCCCGGGAGCAGGG - Intronic
997845319 5:137280864-137280886 GCCTCTGAGCGCTGGGAGGAGGG - Intronic
998054753 5:139064857-139064879 CCCTGTGAGCCCTGTGAAGTGGG - Intronic
998227371 5:140337392-140337414 CACTGTGCCCCCTGGCTGGATGG - Intronic
998392296 5:141795186-141795208 CTCTCTGAGCCTAGGGAGGAAGG - Intergenic
998733900 5:145112660-145112682 CACAGTGAGCACTGTGTGGAAGG + Intergenic
999202194 5:149824482-149824504 TTCTGGGAGCCCAGGGAGGAAGG + Intronic
999380452 5:151117701-151117723 CATCGGGAGGCCTGGGAGGAAGG - Intronic
999926286 5:156382164-156382186 CACTGTGTGGCCTGAGAGTATGG - Intronic
1000266943 5:159647021-159647043 CAGCTTGAGCCCTGGCAGGAAGG - Intergenic
1000801365 5:165730647-165730669 GACTGTGGGGACTGGGAGGATGG + Intergenic
1001536544 5:172502181-172502203 CCCTGGGGGACCTGGGAGGAAGG + Intergenic
1001602792 5:172939891-172939913 CCCTGGGAGCCCTCGGAGGGCGG + Intronic
1001650299 5:173311176-173311198 CAGAGGGAGCCCTGGCAGGAAGG + Intergenic
1001677598 5:173531455-173531477 CACTCAGAGGCCCGGGAGGACGG + Intergenic
1001678297 5:173536632-173536654 CACTGAGACCCCCGGGATGAGGG - Intergenic
1001958111 5:175862238-175862260 GATTGTGAGCTCTTGGAGGATGG - Intronic
1002867017 6:1130644-1130666 GGCTGAGAGCCCTTGGAGGAAGG - Intergenic
1004831266 6:19478690-19478712 CACTGTGAGCCACGGGACCAGGG - Intergenic
1004970743 6:20907623-20907645 CACTGTGAGCCATGGGACTAAGG + Intronic
1005424141 6:25683442-25683464 CCCTGTGTGCCCTGGGAGGCTGG + Intronic
1005807282 6:29486783-29486805 CCCTGTGCTCCCTGGGAAGAAGG + Exonic
1005906825 6:30268823-30268845 GACTGTGATCTCTGGGAGAAGGG + Intergenic
1006056041 6:31385180-31385202 CACTGAGTGACCTGGAAGGATGG + Intergenic
1006112058 6:31753436-31753458 GCCTGTGAGCCCAGGGTGGAGGG + Exonic
1006901755 6:37507345-37507367 CATAGTTAGCCCAGGGAGGAAGG + Intergenic
1007066112 6:38991779-38991801 CACTGTGATATCTAGGAGGAGGG - Intronic
1007367812 6:41407044-41407066 CGCTGTGAGCCCTGGCAGAGAGG - Intergenic
1007483095 6:42162908-42162930 TTCTGTGAGTCCTGGGAGGGGGG - Exonic
1007913308 6:45537246-45537268 CACTGACAGCCCTGGGATGGAGG - Intronic
1007976532 6:46107322-46107344 CACGGTGAGGCCTGGGAACAGGG + Intergenic
1009417422 6:63431111-63431133 CCCTGTGAGCCCTATGAGTAAGG + Intergenic
1009815918 6:68734610-68734632 TATTGTGAACACTGGGAGGATGG + Intronic
1012540091 6:100352504-100352526 CCCTGTTAACCCTGTGAGGATGG + Intergenic
1013976016 6:116079702-116079724 CACTGTGTGCCCTGAGCAGATGG + Intergenic
1015512102 6:134048112-134048134 CACTGTGAGCACTGGGCAAATGG - Intronic
1016075404 6:139789200-139789222 CATGGTGAGCCTTGGGAGGTAGG + Intergenic
1017419284 6:154257171-154257193 AGTTGTGGGCCCTGGGAGGAAGG - Intronic
1017649339 6:156566580-156566602 GGATGTGAGCCCTGGGAGGCCGG - Intergenic
1018474347 6:164124863-164124885 AACTTTGAGCCTTGGGATGAGGG + Intergenic
1019133268 6:169892710-169892732 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019133281 6:169892800-169892822 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019133313 6:169893010-169893032 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019182841 6:170202630-170202652 CACTGTAAGCTCAGGGAGGGCGG - Intergenic
1019255236 7:45633-45655 GAGTGTGAGCCCTGCGAGGAAGG - Intergenic
1020377176 7:7501449-7501471 CTCTTTGTGCCTTGGGAGGAGGG - Intronic
1021414574 7:20367459-20367481 TACTGCGAGCCCTAGGAGCAAGG + Intronic
1022505842 7:30908284-30908306 CCCAGTGAGCCCTAGGAGGCTGG - Intergenic
1023990351 7:45124903-45124925 CATGGGGAGCCCTGGGAGGTGGG - Intergenic
1024853602 7:53750192-53750214 GACTGTGGAGCCTGGGAGGAGGG + Intergenic
1026858578 7:73770391-73770413 CACCGAGCGTCCTGGGAGGAAGG + Intergenic
1026994305 7:74605910-74605932 CATTCTGGGCCCTGGGTGGACGG - Intergenic
1028756887 7:94446113-94446135 GACTGTGAGCCTTGCAAGGAAGG + Intergenic
1029461874 7:100699387-100699409 AGGTCTGAGCCCTGGGAGGATGG - Intergenic
1029563022 7:101316399-101316421 CACTGTGTGTCCTGTAAGGACGG + Exonic
1030686453 7:112492185-112492207 CACAGGGTGCACTGGGAGGAGGG + Intergenic
1031087066 7:117313042-117313064 TACCGTCAGCCCTGGGAGGTGGG + Intronic
1032069015 7:128792308-128792330 CACTGTGGGTCCTGAGAGCAGGG - Exonic
1032195398 7:129785742-129785764 CGCTGTGAGCCGAGGGTGGAGGG - Intergenic
1034489485 7:151385727-151385749 CACTGTGAGCCCCATGAGCAGGG - Intronic
1034521617 7:151625055-151625077 CATTGTAAGCTCTGTGAGGATGG - Intronic
1034535753 7:151724760-151724782 CACTTGGAGCCCTAGCAGGAGGG - Intronic
1035044288 7:155953706-155953728 CCCCGAGAGCCCGGGGAGGATGG + Intergenic
1035129378 7:156638777-156638799 CCCTGTGAACCTTGGAAGGAGGG - Exonic
1035363410 7:158329049-158329071 CACTGGGATCCCTGGGTGGCGGG - Intronic
1035617182 8:1011140-1011162 CACAGTGAGCTCTGGAATGAGGG + Intergenic
1035617186 8:1011174-1011196 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1035617192 8:1011208-1011230 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1035617203 8:1011276-1011298 CACAGTGAGCCCTGGAATGGGGG + Intergenic
1035617216 8:1011344-1011366 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1035617225 8:1011412-1011434 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1035617233 8:1011446-1011468 CACAGTGAGCCCTGGAATGGGGG + Intergenic
1035617241 8:1011480-1011502 CACAGTGGGCCCTGGAATGAGGG + Intergenic
1035617262 8:1011615-1011637 CACAGTGGGCCCTGGAATGAGGG + Intergenic
1035617284 8:1011750-1011772 CACAGTGGGCCCTGGAATGAGGG + Intergenic
1035619892 8:1028896-1028918 CACTGTGAGCCTGTGAAGGACGG + Intergenic
1035642135 8:1192048-1192070 CTCAGAGAGCCCTGGGAGGCTGG - Intergenic
1035976312 8:4315340-4315362 CACTGTGAGCCCCAGGTGGCAGG + Intronic
1036001146 8:4606408-4606430 CACTGTGAGCCCAGGGAGCCAGG - Intronic
1036110984 8:5902111-5902133 CACAGTAAGCCCAGGGAGCATGG + Intergenic
1036497502 8:9282846-9282868 CTCAGTGAGCCCAGGCAGGAGGG - Intergenic
1036643434 8:10598060-10598082 CACTGTGACCCCTGGGTGCATGG + Intergenic
1037102794 8:15067794-15067816 GACTGTGAGCTCTGTGATGATGG - Intronic
1038061867 8:23922830-23922852 CACGCTGGGCGCTGGGAGGATGG + Intergenic
1039182370 8:34880683-34880705 GACTTTGACCCCTGGGAGCATGG - Intergenic
1039383507 8:37108366-37108388 GACTGTGAACCCTGAGAGAAGGG + Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1044262367 8:90140750-90140772 GACTGTGATCCCTGAGAGAAAGG - Intergenic
1045860478 8:106810880-106810902 CATTATGTACCCTGGGAGGAAGG + Intergenic
1045901494 8:107286709-107286731 TACTGTGAGCTATGGGTGGATGG - Intronic
1046777421 8:118179054-118179076 CATTGCCAGCCATGGGAGGAGGG - Intergenic
1047346500 8:124033889-124033911 CTTTGTGAGCCCTGGAGGGAGGG + Intronic
1047537357 8:125732030-125732052 TACAGTGAGCACTGAGAGGAGGG + Intergenic
1047597610 8:126394704-126394726 CACATTGAGGCCTGGGAGGAAGG - Intergenic
1049033064 8:140051276-140051298 CACTGTGGGACCTGCCAGGATGG + Intronic
1049192651 8:141297110-141297132 CAGTGAGGGCCTTGGGAGGAGGG + Intronic
1049830593 8:144699137-144699159 GACTGTAAGCCCTGGGAGATGGG + Intergenic
1050458630 9:5857896-5857918 GACTGTGAGCCCTTAGAGAATGG - Intergenic
1050828077 9:9974721-9974743 GACTGTGAGCTCTTTGAGGATGG + Intronic
1051545381 9:18268537-18268559 CATTGTCAGCCCAGAGAGGATGG - Intergenic
1051600643 9:18869408-18869430 GACTGTGATCCCTGGAAGAAAGG - Intronic
1052495335 9:29216598-29216620 TACTGTGAGCTCTGAGAGCACGG + Intergenic
1052917307 9:33933249-33933271 CACTGGGTCCCCTGGGAGTAGGG - Intronic
1055625562 9:78173796-78173818 AACTGTGATCCCTGAGAGAAGGG - Intergenic
1055804130 9:80074259-80074281 GACTGTGAGCTCTTTGAGGAGGG - Intergenic
1056311034 9:85341147-85341169 CAGTGTGAGCCCTGGGGTGGAGG + Intergenic
1057127026 9:92625007-92625029 AACAGTTAACCCTGGGAGGAAGG + Intronic
1057193431 9:93100009-93100031 CACTGTGAGCCCCTGGAGGATGG + Intronic
1057292963 9:93818892-93818914 CCCTCTGAGCCCTGGCTGGAGGG + Intergenic
1059434705 9:114269100-114269122 CTCTGTGGTCCCTGGGAAGAAGG + Intronic
1060053660 9:120394450-120394472 AACTGGGAGCCCTCGGAGGCAGG + Intronic
1060296879 9:122348892-122348914 GAATGTGAACCCTGGGAGGAAGG + Intergenic
1060669587 9:125458072-125458094 GACTGTGATCCCTGAGAGAAAGG - Intronic
1060970530 9:127735041-127735063 CGCTGGGAGCCCTGGGAGCCCGG - Intronic
1061022799 9:128027094-128027116 CAGGTCGAGCCCTGGGAGGAGGG - Intergenic
1061511972 9:131067136-131067158 CACTGTGAGCACTGTCAGGAAGG + Exonic
1062154307 9:135037945-135037967 CACTGAGAGCTCCAGGAGGAAGG - Intergenic
1062544821 9:137056999-137057021 CACAGGGAGCCCTGTGGGGAGGG + Intergenic
1062552832 9:137097957-137097979 CCCTGAGCGCCCGGGGAGGAAGG - Intronic
1203452553 Un_GL000219v1:133234-133256 CTTTGGGAGACCTGGGAGGAGGG - Intergenic
1185807525 X:3072411-3072433 CACTGTGTACCCTGTGAAGATGG - Intronic
1186519102 X:10189653-10189675 CACTGTTAGTCCAGCGAGGAAGG - Intronic
1189295007 X:39911770-39911792 TCCTGGCAGCCCTGGGAGGAAGG - Intergenic
1190370922 X:49739886-49739908 CAGTGTGAACCCTGGGTGAAGGG + Intergenic
1190452297 X:50594148-50594170 CACTGGCAGGCCTTGGAGGAGGG + Exonic
1191129900 X:56996097-56996119 CACTGTGAGCCCTGGAAAATGGG - Intergenic
1191189984 X:57656261-57656283 CAATCTGTGCACTGGGAGGATGG + Intergenic
1191972260 X:66829596-66829618 CAGTTTTAGCCCAGGGAGGATGG - Intergenic
1196031795 X:111100274-111100296 CACAGTGAGATATGGGAGGAGGG - Intronic
1196555886 X:117084024-117084046 CACTGAACTCCCTGGGAGGAAGG - Intergenic
1196649362 X:118153121-118153143 AACAGGGAGCCCTGGGAGCAGGG - Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197771459 X:130092169-130092191 TGCTGTGGGCCCTGGGAGGCTGG - Intronic
1199642871 X:149881150-149881172 CCAGGTGAGCCCTGGGTGGACGG + Exonic
1199697260 X:150351599-150351621 CAGGGTGAGTCCTGGGAGGTGGG + Intergenic
1200039533 X:153355473-153355495 CACAGGGAGCCCAGGGAGGAGGG - Intronic
1200053567 X:153447005-153447027 CACTGTGAGAGGTGGGAGGCCGG - Intronic
1200149256 X:153943316-153943338 CACAGGGAGCCCAGGGAGGAGGG + Intronic
1200936732 Y:8744825-8744847 CCCTGTGAGCCCCAGGAGGAAGG - Intergenic