ID: 983515819

View in Genome Browser
Species Human (GRCh38)
Location 4:168655566-168655588
Sequence CAACCAACTGAAGCATCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983515814_983515819 13 Left 983515814 4:168655530-168655552 CCTGAGCAATTGAACTTGGCTCT 0: 1
1: 0
2: 0
3: 18
4: 126
Right 983515819 4:168655566-168655588 CAACCAACTGAAGCATCATTTGG 0: 1
1: 0
2: 1
3: 10
4: 108
983515813_983515819 14 Left 983515813 4:168655529-168655551 CCCTGAGCAATTGAACTTGGCTC 0: 1
1: 0
2: 1
3: 14
4: 122
Right 983515819 4:168655566-168655588 CAACCAACTGAAGCATCATTTGG 0: 1
1: 0
2: 1
3: 10
4: 108
983515810_983515819 22 Left 983515810 4:168655521-168655543 CCTCCTTGCCCTGAGCAATTGAA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 983515819 4:168655566-168655588 CAACCAACTGAAGCATCATTTGG 0: 1
1: 0
2: 1
3: 10
4: 108
983515811_983515819 19 Left 983515811 4:168655524-168655546 CCTTGCCCTGAGCAATTGAACTT 0: 1
1: 0
2: 0
3: 3
4: 129
Right 983515819 4:168655566-168655588 CAACCAACTGAAGCATCATTTGG 0: 1
1: 0
2: 1
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983515819 Original CRISPR CAACCAACTGAAGCATCATT TGG Intronic
908582113 1:65526409-65526431 GACCCAACTGAGGAATCATTTGG + Intronic
910530628 1:88231349-88231371 CTATCAACAGAAGCATCATTAGG + Intergenic
910781516 1:90940749-90940771 CAACCAACTGAAGCAGAGGTAGG + Exonic
911561780 1:99415365-99415387 CAATCAACTGCAGAAACATTGGG + Intergenic
917355084 1:174119157-174119179 CAAGGAACTGAAGCATAAGTAGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
919950428 1:202358163-202358185 CAAGGAATTGAAGCCTCATTTGG + Intronic
922896679 1:229106180-229106202 CCACCAACTGTAGGTTCATTTGG - Intergenic
1063240879 10:4168112-4168134 AAATTAAATGAAGCATCATTTGG - Intergenic
1066687064 10:37991460-37991482 CAACAAACAGAAGTCTCATTTGG + Intergenic
1067059875 10:43072796-43072818 GAGCCCACTGATGCATCATTGGG + Intergenic
1069966018 10:72117653-72117675 CAACTTCCTGAAGAATCATTTGG - Intronic
1075113486 10:119606985-119607007 CAAACAACTGAGGGATAATTTGG + Intergenic
1079186536 11:18243212-18243234 TAATTAACTGAAGCAACATTTGG - Intronic
1080936971 11:36874323-36874345 CAAACTACTGAACCATCATTAGG - Intergenic
1081308497 11:41542451-41542473 GAGCCAAATGAAGCATCATGGGG + Intergenic
1091053482 11:132396489-132396511 CACCCAAATGAAGCATCAGCCGG + Intergenic
1091967267 12:4755096-4755118 CAACCTACTGAAATATCAATTGG - Intronic
1094465827 12:30753732-30753754 CAAGTATCTCAAGCATCATTGGG - Exonic
1095640186 12:44478228-44478250 CATTCATCTGTAGCATCATTGGG - Intergenic
1095809008 12:46352038-46352060 GAAGCAACTGAAGCATGAGTAGG + Intergenic
1097298949 12:57997886-57997908 CAACCAGCTGCAGAAACATTGGG - Intergenic
1101886361 12:108666608-108666630 CAACAAACAGAAGCACCACTTGG + Intronic
1102008117 12:109601631-109601653 CAAGCAACTGAAGCATTCATTGG - Intergenic
1104832817 12:131765781-131765803 TAACCAACTGTCGGATCATTTGG + Intronic
1107441063 13:40427734-40427756 CAAGGAACTCAAGCATCATAGGG - Intergenic
1107675133 13:42788239-42788261 CCACCAACTGGTGAATCATTGGG - Intronic
1109743640 13:66589765-66589787 CAATCAACTGCAGTATTATTTGG - Intronic
1112395345 13:99025401-99025423 TAAGCAAGTGAAGAATCATTGGG + Intronic
1115117220 14:29895551-29895573 AAACCAGCTGAAGTCTCATTCGG + Intronic
1117847531 14:59927342-59927364 CATCCAACTGAAGTATTAGTTGG + Intronic
1118397259 14:65348147-65348169 CAACCAACTGAAGAACCACTGGG - Intergenic
1118806031 14:69237692-69237714 CAACCATCTGAAGCAGCAGCTGG + Exonic
1126905908 15:53365214-53365236 CAGCCTACTGTAGAATCATTTGG - Intergenic
1140038923 16:71392499-71392521 CAACCATCTGAAGCCTCGGTCGG + Intergenic
1144885477 17:18455699-18455721 AAACCAACTGAAGTATAAATGGG + Intergenic
1145146743 17:20488673-20488695 AAACCAACTGAAGTATAAATGGG - Intergenic
1147744682 17:42687956-42687978 CAGCGAACTGAAGCTTCTTTCGG - Exonic
1149350872 17:55785782-55785804 AAATAAACTGAAGCATCATCAGG - Intronic
1151022851 17:70639379-70639401 CAAAAAACTGAACCATCATAAGG + Intergenic
1153883712 18:9443886-9443908 CAAAAAATTGAAGAATCATTAGG - Intergenic
1156586459 18:38436506-38436528 AAACCAACTGTAGCATGATTTGG + Intergenic
1159894352 18:73982395-73982417 CACCTGACTGAAGCATCATTAGG - Intergenic
1167985644 19:53312893-53312915 CACTCAGCTGCAGCATCATTAGG - Intergenic
927324383 2:21786632-21786654 GAACCAACAGAAACATAATTTGG + Intergenic
929253552 2:39784435-39784457 CTTCCAACTGGGGCATCATTAGG - Intergenic
931676636 2:64702962-64702984 CAACCAACTGAAGCATCCTGAGG + Intronic
931813962 2:65881820-65881842 CTACCAACTGAAGCCCCTTTGGG + Intergenic
943324297 2:186479649-186479671 CAAGCAGCTGAGGCATCATCAGG + Intergenic
946785525 2:223239455-223239477 CACCCAAATAAAGCCTCATTTGG + Intergenic
1169039627 20:2482420-2482442 CATCGAACTGAAGGATCACTGGG - Exonic
1170524402 20:17224025-17224047 AAACCACCTGAGGCATGATTGGG - Intergenic
1170897495 20:20429056-20429078 CAGCCAACTGCACCAACATTGGG - Intronic
1181379397 22:22488411-22488433 GAATCACGTGAAGCATCATTTGG - Exonic
1181382178 22:22514670-22514692 GAATCACATGAAGCATCATTTGG - Exonic
1184202310 22:42979180-42979202 CAAACAGATGAACCATCATTGGG - Intronic
1184569887 22:45315822-45315844 CCCCCACCTGAAGCAGCATTAGG - Intronic
953320838 3:41969964-41969986 CAAGCAAGGGAACCATCATTAGG + Intergenic
955853978 3:63253379-63253401 TAAACAACTGTAGCATCATTTGG + Intronic
962496175 3:135941716-135941738 CAACCTACTGATGCATCTTAAGG - Intergenic
964737238 3:159929516-159929538 CAACCAACAGAAGCTCCATCTGG + Intergenic
966225721 3:177595820-177595842 CAACCAACCAAAGGATGATTGGG - Intergenic
967086274 3:186097835-186097857 CAACCAACTCAAACAACACTGGG - Intronic
967994436 3:195155956-195155978 CAATCAAATGCAGCATCATGCGG + Intronic
970918390 4:21363468-21363490 TAACCAACTGCATCAACATTAGG + Intronic
971776233 4:30969458-30969480 AAACCAAATGAAGCAACGTTTGG + Intronic
972687525 4:41365396-41365418 CAAACAACACAAGCATCTTTTGG - Intronic
976066973 4:81198717-81198739 CAAAAAACTGATGCCTCATTAGG + Intronic
976921935 4:90452792-90452814 CAAGCAACTGAGGCATTCTTGGG - Intronic
977020396 4:91751746-91751768 GGACCTACTGAAGTATCATTAGG + Intergenic
977791684 4:101112157-101112179 CATACAACTGAAGCATAATCTGG + Intronic
978008730 4:103652089-103652111 CAACCTACTGAGACATCAGTGGG - Intronic
978439467 4:108718340-108718362 TAACCAACTGCAGAATCTTTGGG + Intergenic
979075860 4:116268941-116268963 TAAGCAAATGAAGCATTATTTGG - Intergenic
981095185 4:140771982-140772004 CACCCAACTGAGGCACCCTTGGG - Intergenic
982735939 4:159007101-159007123 CTAGCAACTGAAGCAGCATATGG + Intronic
983515819 4:168655566-168655588 CAACCAACTGAAGCATCATTTGG + Intronic
984220084 4:176964460-176964482 CCACCAACTGAAGCATATTCAGG - Intergenic
985349570 4:189043572-189043594 CAACCAACGGAATGATCATGGGG - Intergenic
987012018 5:13776438-13776460 CCAGCAACTAAAGCATCTTTGGG + Exonic
988337353 5:29923473-29923495 CATTCATCTGCAGCATCATTGGG - Intergenic
990260219 5:54014158-54014180 CAAACAAATGAAGGATCATAGGG + Intronic
990851986 5:60215668-60215690 CAAGCAACAGCAGCATCACTAGG + Intronic
993242119 5:85403644-85403666 CAACCAACAGCTGAATCATTAGG - Intergenic
994783323 5:104120805-104120827 TAACCTACTGAAACTTCATTTGG + Intergenic
994787303 5:104180913-104180935 CATTCATCTGTAGCATCATTAGG - Intergenic
996943047 5:129033132-129033154 CAAACTATTGAAGCATCAGTTGG + Exonic
999394524 5:151218775-151218797 CAGCCAACTGAAGCAAAAATGGG + Intronic
999687620 5:154117008-154117030 CAACCCACTGCAGCCTCTTTTGG + Intronic
1000769713 5:165337460-165337482 CAAACAATTCAAGCAACATTAGG - Intergenic
1005002289 6:21254200-21254222 CAAACAACTGACCCATCAGTTGG - Intergenic
1005400584 6:25429281-25429303 CATCCATCTGAAGCACCATATGG + Intronic
1006218648 6:32468427-32468449 CAAACAACCGAAGCAACATGTGG - Intergenic
1008449776 6:51636969-51636991 GAACTAACTGAAGAATCATTTGG - Intronic
1008790479 6:55226060-55226082 CATCCAATTGCAGCATCATTGGG + Intronic
1015603733 6:134935180-134935202 CTATCAACTGAAGAATCATAAGG - Intronic
1016581710 6:145635410-145635432 CATCAAACTGAAGCATGAATTGG - Exonic
1017676542 6:156820142-156820164 CAGCCAAGGGAAGCAGCATTTGG + Intronic
1022393482 7:29963623-29963645 CTTCCAAATGTAGCATCATTGGG - Intronic
1026358943 7:69585165-69585187 AAACCATATGAAGCATTATTGGG - Intergenic
1026447016 7:70493420-70493442 CAACAAAGTGAAACCTCATTTGG + Intronic
1027555071 7:79653929-79653951 CAAGCTACTGTGGCATCATTTGG + Intergenic
1028887754 7:95953223-95953245 TAAGCAACTGTAGCATCTTTTGG + Intronic
1030823303 7:114122224-114122246 CAAACAACTGAAGCATTCATGGG - Intronic
1031169737 7:118277630-118277652 TAACCAACTAAAGCATATTTGGG + Intergenic
1038203942 8:25446580-25446602 AAAGCAACAGAAGCATCAGTAGG - Intronic
1042822827 8:72950684-72950706 CAGCCAACAGATGTATCATTTGG + Intergenic
1043323948 8:79026456-79026478 CAACCAATAGAAGCATCTGTAGG - Intergenic
1043986853 8:86703735-86703757 CAACCAAGTAAAGCCTCATTCGG + Intronic
1046696083 8:117341037-117341059 CAACCAACTGGCCCATCAATAGG + Intergenic
1046732898 8:117744874-117744896 TAATAAACTGAAGCAGCATTTGG - Intergenic
1048583742 8:135753141-135753163 CAACAAAGTGAAACAACATTTGG - Intergenic
1050332510 9:4559828-4559850 GAAACAACTGAATCATCTTTCGG - Intronic
1052103342 9:24479077-24479099 CTACTAACTGATGCATGATTTGG - Intergenic
1057815772 9:98293037-98293059 TCACCAATTGCAGCATCATTTGG - Intronic
1061746150 9:132741597-132741619 CCTCCAACTGAAGCATCGTGAGG + Intronic
1186086476 X:5996065-5996087 CAACCAAGTGAAAAATAATTAGG + Intronic
1187660213 X:21537665-21537687 AAACCAAATCAAGCATCAGTAGG - Intronic
1190708103 X:53047753-53047775 GGAACCACTGAAGCATCATTTGG + Intergenic
1192411040 X:70932325-70932347 CAACCAGCTGCAGCTCCATTTGG + Intergenic