ID: 983518039

View in Genome Browser
Species Human (GRCh38)
Location 4:168677811-168677833
Sequence CAGGATTAACTGGCGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983518039_983518044 7 Left 983518039 4:168677811-168677833 CCCTACTCCGCCAGTTAATCCTG 0: 1
1: 0
2: 1
3: 2
4: 61
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250
983518039_983518050 23 Left 983518039 4:168677811-168677833 CCCTACTCCGCCAGTTAATCCTG 0: 1
1: 0
2: 1
3: 2
4: 61
Right 983518050 4:168677857-168677879 CTCTCGGTGCCTACACGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983518039 Original CRISPR CAGGATTAACTGGCGGAGTA GGG (reversed) Intronic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
910122929 1:83810338-83810360 CAGAAATAACTGGGGAAGTAAGG - Intergenic
916261651 1:162848287-162848309 TAGGATTAAATGGCAAAGTATGG + Intronic
918962498 1:191298304-191298326 CAGGATTGGCTGGCTGACTAGGG - Intergenic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
924567499 1:245210789-245210811 CAGGACTAGCTGGCTGAGGACGG - Intronic
1069693753 10:70371956-70371978 CAGGGTTACTTGGCTGAGTAAGG + Intronic
1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG + Intergenic
1074969454 10:118523814-118523836 CTGGATAAATTGGAGGAGTATGG - Intergenic
1085843575 11:80041118-80041140 CAGGAGCATCTGGCAGAGTAAGG - Intergenic
1087165911 11:95002035-95002057 CAGGATTTATTGGCTGAGCATGG - Intergenic
1090382011 11:126333989-126334011 CAGAATTAATTGGTGGAGTGGGG + Intronic
1096893701 12:54798117-54798139 CAGGAATAACGGGTGGGGTAAGG - Intergenic
1102419844 12:112794842-112794864 CAGGCTGGACTGGGGGAGTAGGG - Intronic
1109491995 13:63114081-63114103 GAGGATTAACTGGGGGACAAAGG - Intergenic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1112105051 13:96231189-96231211 CAGGATCAACAGGCACAGTAAGG - Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1114901608 14:27067378-27067400 CAGGAGTAAATGGCGGGGTCAGG - Intergenic
1117018276 14:51541500-51541522 TAGGATTCAATGGCGGGGTAGGG + Intronic
1123134182 14:106012106-106012128 CAGTAGTAACTGGTGGAGTTGGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1135341967 16:21656181-21656203 CAGCATTAACTGGGGGGGTGGGG - Exonic
1138434378 16:56989127-56989149 CAGGATGAACTAGGGGAGAAGGG - Intergenic
1145288566 17:21524250-21524272 GAGGATTAAATGGCGGCGGAGGG - Intergenic
1150630087 17:66874199-66874221 CAGGATTAAAATGGGGAGTAAGG + Intronic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1159652088 18:70989181-70989203 CAGAATTATCTGGGGAAGTATGG - Intergenic
1159745105 18:72223736-72223758 CAGAAATAACTTGTGGAGTAAGG - Intergenic
928474437 2:31611985-31612007 AAGGATAAACTGGCTGAGTGTGG + Intergenic
943384516 2:187184888-187184910 CAGGATCAGCTGGCAGAGAAAGG - Intergenic
944959886 2:204860042-204860064 CAGGATTAACTGTAGAAATACGG + Intronic
947622980 2:231603011-231603033 CCGGATTAACGGGCGAGGTAAGG + Intergenic
948453855 2:238095217-238095239 CAAAAATAACTGGCAGAGTAAGG + Intronic
1174266853 20:49338169-49338191 CAGGAAGGACTGGCGGAGCAGGG + Intergenic
1178594959 21:33945012-33945034 CAGGATCAACAGGCAGAGCACGG + Intergenic
1179663320 21:42892449-42892471 CAAGATAAACTGGCGGAATGAGG - Intronic
1185141949 22:49107583-49107605 CAGGAATTACTGGAGGAGTGCGG - Intergenic
953411800 3:42694628-42694650 CATGATGAACTGGGGGAGCATGG - Intronic
954369924 3:50164893-50164915 GAGGATTAACTGTGTGAGTATGG + Intronic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
960025020 3:112998864-112998886 CAGGAATATCTGGTGGATTAAGG + Intronic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG + Intronic
967100177 3:186209888-186209910 GAGGATTAGCTGGGGGAGTGGGG - Intronic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
976418681 4:84811549-84811571 CATGATTAAGTGCAGGAGTAGGG - Intronic
979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG + Intergenic
979459969 4:120970868-120970890 CAGGATTCACTCTCGGAGTTTGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
995555169 5:113320497-113320519 CAGTATTAACTGGCAAAGCAGGG + Intronic
999679624 5:154044524-154044546 CAGTATTAACTGGATGTGTAAGG + Intronic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1019112650 6:169729015-169729037 CAGAATTTACTGGCTGAATAAGG + Intergenic
1032443351 7:131959471-131959493 CAGGATTAACCCACGGAATAAGG + Intergenic
1032514048 7:132493880-132493902 CAGGATTAAGTGGCAGAGTTGGG - Intronic
1037735605 8:21563479-21563501 CAGGAATAATTGGGGAAGTATGG - Intergenic
1041410941 8:57553952-57553974 CAGGATTTTCTTGCTGAGTAGGG + Intergenic
1050614531 9:7388241-7388263 CAGGATCAACTGGCAGAGGGTGG - Intergenic
1056279348 9:85025540-85025562 CAGGATTACCTGGTCAAGTATGG + Exonic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1196407557 X:115380610-115380632 CAGCTTTAAGTGGCTGAGTATGG + Intergenic
1201765585 Y:17571058-17571080 CAGGATTAACTGAATGAGTGTGG - Intergenic
1201835967 Y:18334931-18334953 CAGGATTAACTGAATGAGTGTGG + Intergenic