ID: 983518044

View in Genome Browser
Species Human (GRCh38)
Location 4:168677841-168677863
Sequence ACTTTTCCAGCCCCCACTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 250}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983518038_983518044 17 Left 983518038 4:168677801-168677823 CCGTTTGTGTCCCTACTCCGCCA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250
983518039_983518044 7 Left 983518039 4:168677811-168677833 CCCTACTCCGCCAGTTAATCCTG 0: 1
1: 0
2: 1
3: 2
4: 61
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250
983518041_983518044 0 Left 983518041 4:168677818-168677840 CCGCCAGTTAATCCTGCACACTG 0: 1
1: 2
2: 0
3: 12
4: 168
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250
983518040_983518044 6 Left 983518040 4:168677812-168677834 CCTACTCCGCCAGTTAATCCTGC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250
983518042_983518044 -3 Left 983518042 4:168677821-168677843 CCAGTTAATCCTGCACACTGACT 0: 1
1: 0
2: 1
3: 14
4: 104
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250
983518037_983518044 18 Left 983518037 4:168677800-168677822 CCCGTTTGTGTCCCTACTCCGCC 0: 1
1: 0
2: 1
3: 6
4: 100
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250
983518036_983518044 19 Left 983518036 4:168677799-168677821 CCCCGTTTGTGTCCCTACTCCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG 0: 1
1: 1
2: 2
3: 14
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983518044 Original CRISPR ACTTTTCCAGCCCCCACTCT CGG Intronic
900510812 1:3060189-3060211 TCCTTCCCAGCACCCACTCTTGG - Intergenic
901066026 1:6495063-6495085 ACTGTCCCAGCCCCTCCTCTGGG - Intronic
902184533 1:14715243-14715265 CCTTTTCCAGCCACTATTCTGGG - Intronic
902854610 1:19192188-19192210 CCTTTTCCAGGCCCCAGTTTAGG + Exonic
903189123 1:21646735-21646757 AAATGTCCAGCCCCCATTCTAGG + Intronic
903318415 1:22526804-22526826 GCATTTGCAGCCCCCACTGTGGG - Exonic
903338629 1:22641004-22641026 ACTCTCCCAGCCCCCAGCCTGGG - Intergenic
905884022 1:41482158-41482180 ACGTGTCCTGCCCCCTCTCTGGG + Intronic
907446232 1:54509686-54509708 TCTTGTCCAGCCTCCACTTTTGG - Intergenic
907741860 1:57174111-57174133 TTTTCTCCAGCTCCCACTCTAGG - Intronic
908875935 1:68675703-68675725 ACTGTTCCAGCCCTCAGTTTAGG + Intergenic
909423603 1:75494874-75494896 ACTTTTCTAGCTGCTACTCTAGG + Intronic
913084427 1:115423661-115423683 GCTTCTCCAGCACCCAGTCTGGG + Intergenic
913540697 1:119817975-119817997 CCTTTTCCAGCCACCTCACTAGG + Intergenic
915612299 1:157004318-157004340 ACTTGCCCAGCCCCCATTTTTGG - Intronic
915737755 1:158095377-158095399 ACTTTCCCTGTCCCCATTCTAGG - Exonic
916100496 1:161389923-161389945 TCTTGTCCAGCCCCCGCTGTCGG + Intergenic
917076186 1:171207480-171207502 CCTTTTCCAGCCTCTTCTCTTGG + Intronic
918044542 1:180933830-180933852 ACTGTTCCAACCCCCACTCCAGG - Intronic
918550202 1:185733958-185733980 AATTTTCCAGCTCCCCCTCCTGG + Intergenic
919584709 1:199422075-199422097 ACTTTTACAGCTCCCAATCAAGG + Intergenic
921034950 1:211368065-211368087 ACTTTTTAAGCCTCCACTCATGG - Intronic
922466762 1:225849770-225849792 ACCTAACCAGCCCTCACTCTGGG + Intronic
924506038 1:244684853-244684875 ACTTTTGCTGCCCAAACTCTGGG + Intronic
924870955 1:248044131-248044153 CATTTTCCAGCCCTCACTCAAGG + Intronic
1065592864 10:27283287-27283309 GCTTTTCCAGTACCCAGTCTAGG + Intergenic
1065657502 10:27966997-27967019 GCTTTTCCAGTACCCAGTCTAGG - Intronic
1065863996 10:29897783-29897805 ACTTTGCCAACCACCATTCTAGG + Intergenic
1066673209 10:37861322-37861344 ACATGTCCAGCCCACACTCAAGG + Intergenic
1067958472 10:50820086-50820108 GCTTCCCCAGCCCCTACTCTTGG + Intronic
1069906310 10:71734563-71734585 GCTCTTCCAGACCCCACTCCCGG - Intronic
1074762860 10:116680377-116680399 GATTTTCCAGCCCCCGCCCTTGG - Intronic
1075276234 10:121095308-121095330 CTTTTTCCAGCCCCCACCCATGG + Intergenic
1075453223 10:122567790-122567812 ACTTTTCCAGCCTCCTCTCCTGG - Intronic
1075753407 10:124791939-124791961 ACTGCTCCAGCCCCCGCGCTGGG + Intergenic
1076223053 10:128750117-128750139 GCTTTTCCAGTTCCCACTTTGGG + Intergenic
1077233564 11:1469325-1469347 TCTGCTCCAACCCCCACTCTCGG + Intergenic
1078863767 11:15277736-15277758 ATTTTTCTGGCCTCCACTCTCGG - Intergenic
1079214795 11:18499147-18499169 ACTTTTCCTGCCACCACTATTGG - Intronic
1079766722 11:24403214-24403236 ACTTTTCCTGCCCACACTTGTGG - Intergenic
1080850802 11:36068117-36068139 ATTCTTGCAGCCCCCACACTTGG + Intronic
1081171182 11:39871628-39871650 TCTTTTCCAGCACTCAATCTGGG - Intergenic
1081321135 11:41693157-41693179 ACATTTCCTCCACCCACTCTAGG + Intergenic
1081656150 11:44858768-44858790 CCTGTCCCAGTCCCCACTCTTGG - Intronic
1083105230 11:60351187-60351209 CCATCTCCAGCCCCCACTTTGGG + Intronic
1083108491 11:60381897-60381919 ACTTTTCCATCTCCCTCACTAGG + Intronic
1083309521 11:61777238-61777260 ACTGATCCAGCCCCAACTCGCGG + Intronic
1084332102 11:68436490-68436512 CCTTCCACAGCCCCCACTCTCGG + Intronic
1085277249 11:75307996-75308018 ACTTTATCAGCACCCACTCCTGG + Intronic
1085297924 11:75441362-75441384 GCTTTACCAGCCCCGACACTGGG - Intronic
1085348362 11:75782549-75782571 ACTTGTCCAGCCCCAGCCCTTGG + Intronic
1087220583 11:95542542-95542564 ACTTTTCCTGACCCTACTCATGG - Intergenic
1087611704 11:100442432-100442454 TCTTTTGGAGCACCCACTCTTGG - Intergenic
1089338137 11:117739712-117739734 ACTTTCCCAGCCACCACTAATGG - Intronic
1092900851 12:13058134-13058156 GCTTTTCCAGCACCCTATCTGGG + Intronic
1092940234 12:13401276-13401298 TCTTTCCCCTCCCCCACTCTAGG - Intergenic
1095261870 12:40106417-40106439 TTTTTTCCAGCCCTCTCTCTAGG - Intergenic
1096559474 12:52425171-52425193 AATATTCCAGCCTCCACCCTGGG - Intronic
1100746296 12:97649942-97649964 GCTTTTCCAGTCCCCAGTCCTGG - Intergenic
1100774956 12:97963682-97963704 CCCTTTCCAGGGCCCACTCTTGG + Intergenic
1102378683 12:112444878-112444900 ACTTTTACTGCCCCAACGCTGGG + Intronic
1102788266 12:115621781-115621803 ACTTTGCCAGCCACCACAATTGG - Intergenic
1104620349 12:130307417-130307439 ACCCTTCCAGCCCCCACTGCAGG + Intergenic
1105468123 13:20666434-20666456 TGGTTTCCAGACCCCACTCTGGG + Intronic
1107202843 13:37742485-37742507 ACTTTTCCATCTCCTCCTCTAGG - Intronic
1109474408 13:62859947-62859969 AGTTTTCCAACACCAACTCTAGG + Intergenic
1111505728 13:89185809-89185831 ACTTTTCCTGGGCCCACTCATGG + Intergenic
1112154545 13:96803154-96803176 ACTTGTCCAGCCTCCACTGGGGG - Intronic
1114782240 14:25550643-25550665 ACTGTTCCATCCCTCACTCAAGG + Intergenic
1116779506 14:49220890-49220912 TCTTTTACAGCCCACACTCACGG + Intergenic
1117542124 14:56758454-56758476 CCATTTTCAGCCCCCACTCGTGG + Intergenic
1117630327 14:57684284-57684306 ATGTTTGCAGCCCCCACCCTAGG + Intronic
1119466323 14:74861716-74861738 CCGTTTCCAGCCACCTCTCTGGG + Intronic
1119724469 14:76913816-76913838 CCTTCTCCAGCACCCACCCTAGG + Intergenic
1121107879 14:91292955-91292977 CCTTTTCCAGCCTTCTCTCTGGG + Intronic
1121582463 14:95041127-95041149 TCATTTCCAGCCCTCTCTCTGGG + Intergenic
1122438714 14:101715962-101715984 CCACTTCCAGCCTCCACTCTTGG + Intergenic
1124183076 15:27496480-27496502 GCTTTTTCAGCCCCTATTCTGGG + Intronic
1124552722 15:30696449-30696471 GCTTTTCCAGCCCTGAGTCTTGG + Intronic
1124678520 15:31709221-31709243 GCTTTTCCAGCCCTGAGTCTTGG - Intronic
1126373928 15:47975453-47975475 CCTTTTCCAGCATCCACTCAGGG + Intergenic
1127612467 15:60650444-60650466 GCTTTCCCCTCCCCCACTCTGGG - Intronic
1128055406 15:64695715-64695737 GTGTTTCAAGCCCCCACTCTGGG + Intronic
1129077037 15:73005741-73005763 ACCTCTCCAGCTCCCACCCTGGG - Intergenic
1131995416 15:98128225-98128247 ACTTTTGCAACTCACACTCTGGG + Intergenic
1132548806 16:545792-545814 ATCTTTGCAGCCCCCACTCCGGG - Intronic
1133458657 16:5966760-5966782 ACTCCACCAGCCCCCACCCTTGG + Intergenic
1135838094 16:25846220-25846242 ACTTTTCCTACCTCCATTCTAGG - Intronic
1136381610 16:29898682-29898704 ACTTTCCCAGCCCTCCTTCTTGG + Intronic
1137787034 16:51148329-51148351 ACTTTTCTAGGTCTCACTCTGGG + Intronic
1139424030 16:66867933-66867955 ACTCTTCCTCCCTCCACTCTGGG + Intronic
1140618953 16:76704312-76704334 ACTATTCCAGCACACACTCCAGG - Intergenic
1141185347 16:81783072-81783094 TTCTTTCCAGCCCTCACTCTGGG - Intronic
1141714474 16:85718880-85718902 ACTGTTCCAGCCCCGAGTGTGGG + Intronic
1142286310 16:89172945-89172967 CCTTTCCCAGCCCCCACTGAAGG + Intronic
1142603198 17:1067285-1067307 GCTCTTCCAGCCTCAACTCTTGG + Intronic
1142866114 17:2792562-2792584 CCCTTTCCAGCCCTCAGTCTGGG + Intronic
1142987818 17:3707639-3707661 ACTAGTCCAGACCCCCCTCTCGG + Intergenic
1143012188 17:3872210-3872232 ACTTCTCCTTCCCCCACTCAGGG - Intronic
1143410018 17:6703105-6703127 ATTTTTGAAGGCCCCACTCTGGG - Exonic
1144667726 17:17113055-17113077 ACAGTTCCAGCCCCAACCCTGGG - Intronic
1145006739 17:19342721-19342743 AGGTTTCCAGCCCCCATCCTTGG + Intronic
1145812704 17:27774113-27774135 AGCTTTCCAGGCCCCACTCAAGG - Intronic
1152590844 17:81211247-81211269 ACCTTTCCAGCGCCCAGTTTGGG - Intronic
1154107303 18:11533904-11533926 GTGTTTCCAGTCCCCACTCTAGG + Intergenic
1155912393 18:31519217-31519239 ACTTTTCAAACTCTCACTCTGGG + Intronic
1156318403 18:35993898-35993920 TCCTGTCCAGCCCCCACTCCTGG + Intronic
1157153882 18:45245866-45245888 AATTTTCAAGCTCCCATTCTTGG + Intronic
1160160502 18:76466722-76466744 ACTTTTCCAGCCCCCACTGTAGG - Intronic
1161750390 19:6092011-6092033 AGTTTTCCTCCCCCCACTCCCGG - Intronic
1161772994 19:6241519-6241541 ATTCTTCCAGCCCCTTCTCTAGG + Intronic
1163530168 19:17844158-17844180 ACTATTCCAGCTTCCAATCTTGG + Intronic
1163609778 19:18294856-18294878 AACTTTCCAGCCTCCACCCTGGG + Intergenic
1164962122 19:32442626-32442648 ACTTCTCCAGCACCCAGTCAAGG - Intronic
1165886589 19:39083650-39083672 TCTTATCCAGCCCTTACTCTGGG + Intergenic
1167430091 19:49449249-49449271 ACTTTTCCATGCCCCACTCCAGG - Intronic
1167486372 19:49765567-49765589 ACTTTCCCAGGCCCCATTCCTGG + Intergenic
1167516024 19:49923650-49923672 CCTATGCCAGGCCCCACTCTAGG + Intronic
1168721187 19:58555814-58555836 GCTTGTTCAGCCCCCACTCTGGG - Exonic
925819283 2:7783674-7783696 TCTCTTCCAGCTCCCAGTCTGGG - Intergenic
926211855 2:10877140-10877162 ACTTTTCCAGCACTCAGGCTAGG - Intergenic
929100827 2:38311943-38311965 GCATTTCCAGACCCCACTTTTGG - Intronic
930208408 2:48611097-48611119 GCTTCTCCAGCACCCAATCTAGG + Intronic
931361774 2:61583990-61584012 AGTGATCCAGCCCCTACTCTTGG - Intergenic
934962563 2:98689957-98689979 ACTTTTCTAGTTCCCATTCTAGG - Intronic
935285600 2:101561344-101561366 ACTTTTCCAGCCCCCAACCCAGG - Intergenic
936963186 2:118098542-118098564 ACTTTTCAAGCCTCCAGACTGGG + Intronic
937089978 2:119199640-119199662 ACTTGGCCAGCCCCCACTTTGGG - Intergenic
937122219 2:119448820-119448842 GCTTTTCCAGCCACCTCTCCTGG + Intronic
942151740 2:173082563-173082585 ACCTATCCTGCCCCCACCCTAGG - Intronic
943964921 2:194320646-194320668 AATTTTCATGCCCCAACTCTGGG + Intergenic
944882985 2:204033827-204033849 ACTTTTCCACACCCCTTTCTGGG - Intergenic
944918621 2:204387527-204387549 ACTTTTCCAGCCTCCACTATTGG + Intergenic
946603774 2:221379573-221379595 ACATTTCCAGGTCCCACCCTGGG + Intergenic
946695979 2:222359805-222359827 ACATTTCATGCCCCCACTCTAGG + Intergenic
1172190909 20:33061383-33061405 ACTTGTTGAACCCCCACTCTGGG + Intronic
1172858345 20:38025955-38025977 ACTTTTTCAGCCTGCCCTCTTGG - Intronic
1173565414 20:44035108-44035130 ACTGTACCAGCCCCCTCTCTGGG + Intronic
1173863767 20:46300897-46300919 ATTTAACCAGCCCCCACTGTTGG - Intronic
1176247272 20:64103369-64103391 ACATGTCCAGCCCACACTCGGGG - Intergenic
1177805912 21:25874593-25874615 AGTTTTCCAGATCCCATTCTGGG - Intergenic
1178360513 21:31945420-31945442 ACTTTTCCAGCCAGCATTCAGGG + Intronic
1179465510 21:41569135-41569157 TCCTTTCCAGACCCCACCCTCGG + Intergenic
1181953812 22:26573795-26573817 AATTTGCCAGCCCCAATTCTGGG + Intronic
1183819109 22:40330371-40330393 ACTTTTACAGCCACCCCTCTGGG - Exonic
1184437460 22:44488124-44488146 AGATTTCCAGCCCCCACCCATGG + Intergenic
1184874232 22:47262979-47263001 ACTTTTCCAGCACCTCCTTTAGG - Intergenic
1185394871 22:50581757-50581779 ACTGTTCCAGCCGGCCCTCTGGG + Exonic
949466783 3:4352560-4352582 ACTATTGCAGCCTCCACTCAAGG - Intronic
949710623 3:6866433-6866455 GCATTTCCAGCTCCCACTTTTGG + Intronic
950389858 3:12688060-12688082 ACCTTTCTAGCCCCCACATTTGG + Intergenic
950863764 3:16172986-16173008 AGTTTTCCCCCCTCCACTCTTGG + Intergenic
953868921 3:46609450-46609472 ACTGTTCCTGCCCCCACTGGGGG + Intronic
954334065 3:49905968-49905990 ACTTTGCCAGTCCCCTCTCCTGG + Intronic
955333358 3:58065597-58065619 TCTCTTCCAGCCCCCTCTCCTGG - Intronic
955675235 3:61441398-61441420 CTTGTTCCAGACCCCACTCTTGG - Intergenic
960179595 3:114559750-114559772 TCCTTTCCAGCACCAACTCTGGG + Intronic
962967538 3:140368507-140368529 ACTTTCTCATCCCCCACTCCAGG + Intronic
965031262 3:163371102-163371124 ACTTGTCCTGCCCACACTCAAGG - Intergenic
967266981 3:187699683-187699705 TCTTTTCCAGTCCCCACTGCAGG - Intronic
967446986 3:189578280-189578302 CCTGCTCCAGCCCCCACTCAAGG - Intergenic
967821545 3:193843495-193843517 AGTTTGCCAGCCCCTGCTCTAGG + Intergenic
969071641 4:4544107-4544129 ACTTTCCCGGCCCCCTCCCTGGG - Intergenic
972975325 4:44627146-44627168 GCTTTTTCAGACCACACTCTTGG + Intronic
976745886 4:88402611-88402633 ACCCTTCCTGCCCTCACTCTTGG - Intronic
979800785 4:124906121-124906143 CCTCTTCCAACCCCCTCTCTAGG - Intergenic
982000354 4:151015957-151015979 ACTTTCCCCTCTCCCACTCTCGG + Intergenic
983518044 4:168677841-168677863 ACTTTTCCAGCCCCCACTCTCGG + Intronic
984277954 4:177633304-177633326 ACTTTTCAAGCGCTCACTCAAGG + Intergenic
985698526 5:1357003-1357025 CGTTTTCCAGCCCTCACTCGAGG + Intergenic
985747935 5:1657709-1657731 ACTTGTCCAGCCCCCTGTGTGGG + Intergenic
987277042 5:16373501-16373523 ACTTTCCCATCCCCTGCTCTGGG + Intergenic
989218833 5:38932584-38932606 ATTCTGACAGCCCCCACTCTGGG - Intronic
989271102 5:39533906-39533928 ACATTTCCTGCCCCAGCTCTTGG + Intergenic
989500452 5:42160477-42160499 ACCCTTCCTGCCCCCACTTTTGG + Intergenic
990450671 5:55929402-55929424 TATTTTCCAGCCCCCTCTCAGGG + Intergenic
991139760 5:63226618-63226640 TCTTTAACAGCCCCCACTCAGGG - Intergenic
992879186 5:81088214-81088236 ACATTCCCAGCCCCCAGGCTGGG - Intronic
997102582 5:130985467-130985489 ACTTTTTCCTCCCCCTCTCTTGG + Intergenic
997611145 5:135216615-135216637 GCTTTTCCAGCCCCCACTTTGGG + Intronic
998391905 5:141792644-141792666 AAAATTCCAGCCCCCTCTCTCGG + Intergenic
999137551 5:149332576-149332598 GCCCTTCCAGCCCCCAGTCTTGG - Intronic
1000294611 5:159902582-159902604 ACTCTTCAAGGCCCCACCCTGGG + Intergenic
1000481493 5:161781250-161781272 TCTCTTACAGCCTCCACTCTAGG - Intergenic
1002559015 5:180068161-180068183 CCTCTCCCAACCCCCACTCTGGG + Intronic
1003840622 6:10115448-10115470 ACAGTTCCAGCCCACAGTCTAGG - Intronic
1006335754 6:33419834-33419856 ACTTCACCACCCCCCACTGTGGG - Intergenic
1007197032 6:40071231-40071253 ACTTTTGGAGCCCCTACTTTTGG + Intergenic
1007782089 6:44260216-44260238 ACTGTACCAGGCCCCGCTCTTGG + Exonic
1008446298 6:51595877-51595899 ACTTTTACAGCTCCCACTGGAGG - Intergenic
1009977332 6:70685480-70685502 CCTTCCCCAGCCCCCATTCTTGG - Intronic
1010523182 6:76866983-76867005 GCTTTTCCAGCACCCAGTCTTGG - Intergenic
1012768915 6:103404472-103404494 ACTTTATGAGCCACCACTCTTGG + Intergenic
1013101477 6:106990757-106990779 ACTGTTCCTGCCCACACTCAGGG + Intergenic
1014207611 6:118673105-118673127 ACTTGTCCTGCCCCCAACCTTGG - Intronic
1019729847 7:2623752-2623774 CCTCTTCCAGCCCCCAGCCTAGG - Intergenic
1020210960 7:6158005-6158027 AGTTTGCCAGCCTCCGCTCTAGG - Intronic
1021631508 7:22651997-22652019 ACTCATCCAGCTGCCACTCTTGG - Intergenic
1023305762 7:38825143-38825165 ACTCCTCCAGCCCCTACTGTGGG - Intronic
1023395784 7:39750774-39750796 AGTTTGCCAACCCCTACTCTAGG + Intergenic
1024082236 7:45865092-45865114 ACTTTTCCGGCCAGCAGTCTTGG - Intergenic
1024468722 7:49743030-49743052 ATTTTTTCAGCCTCTACTCTAGG - Intergenic
1024501182 7:50107849-50107871 ACTTTTTCTGCCACTACTCTTGG - Intronic
1024673195 7:51615357-51615379 TCTTTTGCAGCCACCACTCATGG + Intergenic
1026493609 7:70884132-70884154 ATTTTTCCCTCCCCCATTCTGGG - Intergenic
1029414141 7:100432501-100432523 ACTTTGCCAGCCCCAACTGCAGG + Intronic
1029832918 7:103280047-103280069 ACTTTTCCACCTCCCGCTCCCGG + Intergenic
1030836003 7:114286591-114286613 ACATTAGCAGGCCCCACTCTTGG - Intronic
1030939740 7:115631191-115631213 AATTTTCCAGCCTCATCTCTTGG - Intergenic
1031024927 7:116669901-116669923 CCTGTTCCTGCCTCCACTCTTGG - Intergenic
1032403453 7:131639432-131639454 ATTTTTCCCGCTCCCTCTCTGGG + Intergenic
1033359622 7:140629372-140629394 ACTTTCCCTTCCCCAACTCTTGG - Intronic
1034058496 7:148063355-148063377 ACTCTCCCAACCCCCACTTTTGG + Intronic
1034226800 7:149490764-149490786 ACTCTTCCTGCCCTCAGTCTTGG - Intronic
1034241944 7:149617520-149617542 ACTCTTCCGGCCCTCAGTCTTGG - Intergenic
1034465256 7:151224253-151224275 ATCTTGCCAGCCCCCATTCTTGG + Intronic
1035189535 7:157153715-157153737 ACTTTTCCTCCCGGCACTCTGGG + Intronic
1037110962 8:15164203-15164225 ACTTCTCAAGCCCCCACATTGGG - Intronic
1038127977 8:24695792-24695814 ACTTTTCTAGCATCCACTTTTGG - Intergenic
1038440286 8:27566639-27566661 CCTTTTCCAGAGCCCACACTTGG + Intergenic
1039251924 8:35675559-35675581 TCATTTCCAGCCCTCTCTCTTGG - Intronic
1039369859 8:36973519-36973541 AGTTTGCCAGCCCCTACTCTAGG + Intergenic
1041644971 8:60242462-60242484 TCTTTTCCAACCCTCCCTCTTGG - Intronic
1042117622 8:65449423-65449445 ACTTCTCGAGCCCCCACTTGGGG + Intergenic
1045189317 8:99867274-99867296 ACTTTTCTAGCTCTCACTGTTGG + Intronic
1045967250 8:108039652-108039674 ACCCATCCAGCCTCCACTCTAGG + Intronic
1046522664 8:115345400-115345422 ACTTTTCGAGCACCCACTACTGG + Intergenic
1047445302 8:124913942-124913964 AGTTTTGCAGTCCCCAGTCTAGG + Intergenic
1048237890 8:132710139-132710161 CCCTTTCCACCCCCCACACTTGG - Exonic
1049570706 8:143369095-143369117 CCTTTTCCTGCCCCCCCTCGAGG + Intronic
1050302312 9:4272089-4272111 ACTTTTTGAGCCCTTACTCTGGG - Intronic
1051963186 9:22793326-22793348 ACATTTGCAGCCCCTACTGTGGG + Intergenic
1055656261 9:78452999-78453021 ACTTCTGCAGCCTCCACCCTGGG - Intergenic
1055719853 9:79160800-79160822 TCTTTTCAAGCCACCACTGTGGG - Intergenic
1056381861 9:86063140-86063162 GCTTTTCAAGCCCCCGCTCCTGG - Intronic
1057188338 9:93071795-93071817 ACATTTCCAGCTGCAACTCTGGG + Intronic
1057389636 9:94632236-94632258 ACATTTCCTGCAGCCACTCTTGG + Intronic
1058697897 9:107575119-107575141 ACATTCTCAGGCCCCACTCTGGG - Intergenic
1060453940 9:123772291-123772313 GATTTTAAAGCCCCCACTCTTGG - Intronic
1062594883 9:137295210-137295232 ACTTTTCCAGACCCTCGTCTGGG + Intergenic
1187780908 X:22822893-22822915 GCTTTTTCAGCTCCAACTCTGGG + Intergenic
1187921935 X:24212645-24212667 TCTTTTCCATCCCCCTCACTAGG - Exonic
1190034148 X:47005105-47005127 GCTTCTCCAGCACCAACTCTGGG - Intronic
1190128271 X:47724537-47724559 ACTTTTCCACCCCCCATCCAGGG + Intergenic
1192148975 X:68700122-68700144 ACTCTTCTAGGCCCCACTGTGGG - Intronic
1192546021 X:72015102-72015124 ACTTTTTCAGCTTCAACTCTGGG + Intergenic
1193085132 X:77442119-77442141 ACTTTCCCACCCCCAATTCTAGG - Intergenic
1193901246 X:87180513-87180535 GCTTTTCCAGCACCCATCCTGGG + Intergenic
1194284396 X:91991396-91991418 GCTTTTCCAGTACCCAGTCTGGG + Intronic
1194440224 X:93923539-93923561 ACTTTTGCTGCACCCTCTCTAGG - Intergenic
1195423360 X:104699828-104699850 AGTTTGCCAGCCCCTACTCTAGG + Intronic
1195620868 X:106953462-106953484 ACTTTTCCAACTCCCATTTTAGG - Intronic
1197124551 X:122929070-122929092 ACTCATGCAGCCCTCACTCTTGG - Intergenic
1198130945 X:133694525-133694547 ACTCTTTCAGCTTCCACTCTTGG - Intronic
1199050445 X:143231108-143231130 ACTTTCCAAGCACCCACTTTAGG - Intergenic
1199544259 X:148990618-148990640 ACTTTTCCAGCCCCTGACCTAGG - Intronic
1199606305 X:149582420-149582442 AGTTTTCCTGCACCCAATCTTGG + Exonic
1199615023 X:149649362-149649384 AGTTTTCCTGCACCCAGTCTTGG + Intergenic
1199623148 X:149716566-149716588 ACTTTTCCTGCACCCAATTTTGG - Exonic
1199627971 X:149758074-149758096 ACTTTTCCTGCACCCAATCTTGG + Intergenic
1199632817 X:149786948-149786970 AGTTTTCCTGCACCCAATCTTGG - Exonic
1199635602 X:149808945-149808967 AGTTTTCCTGCACCCAATCTTGG - Intergenic
1199643671 X:149885022-149885044 AGTTCTCCTGCACCCACTCTTGG - Exonic
1199875462 X:151924408-151924430 AGTTTTCCTGCACCCAATCTTGG - Exonic
1199877538 X:151946333-151946355 ACTTCTCCAGTCCACACACTGGG - Intergenic
1199896791 X:152134783-152134805 AGTTTTCCTGCACCCAATCTTGG + Exonic
1200018586 X:153183109-153183131 ACTTTTCCTGCACCAAATCTTGG - Exonic
1200601965 Y:5215955-5215977 GCTTTTCCAGTACCCAGTCTGGG + Intronic