ID: 983518050

View in Genome Browser
Species Human (GRCh38)
Location 4:168677857-168677879
Sequence CTCTCGGTGCCTACACGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983518042_983518050 13 Left 983518042 4:168677821-168677843 CCAGTTAATCCTGCACACTGACT 0: 1
1: 0
2: 1
3: 14
4: 104
Right 983518050 4:168677857-168677879 CTCTCGGTGCCTACACGACCAGG No data
983518039_983518050 23 Left 983518039 4:168677811-168677833 CCCTACTCCGCCAGTTAATCCTG 0: 1
1: 0
2: 1
3: 2
4: 61
Right 983518050 4:168677857-168677879 CTCTCGGTGCCTACACGACCAGG No data
983518043_983518050 4 Left 983518043 4:168677830-168677852 CCTGCACACTGACTTTTCCAGCC 0: 1
1: 0
2: 0
3: 21
4: 231
Right 983518050 4:168677857-168677879 CTCTCGGTGCCTACACGACCAGG No data
983518041_983518050 16 Left 983518041 4:168677818-168677840 CCGCCAGTTAATCCTGCACACTG 0: 1
1: 2
2: 0
3: 12
4: 168
Right 983518050 4:168677857-168677879 CTCTCGGTGCCTACACGACCAGG No data
983518040_983518050 22 Left 983518040 4:168677812-168677834 CCTACTCCGCCAGTTAATCCTGC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 983518050 4:168677857-168677879 CTCTCGGTGCCTACACGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983518050 Original CRISPR CTCTCGGTGCCTACACGACC AGG Intronic
No off target data available for this crispr